Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CAJ1
Systematic Name YER048C
Description Nuclear type II J heat shock protein of the E. coli dnaJ family, contains a leucine zipper-like motif, binds to non-native substrates for presentation to Ssa3p, may function during protein translocation, assembly and disassembly
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CAJ1	6320888 upstream sequence, from -1000 to -1, size 1000
CGGCAACAATGCAATCCGAACAATTATCAAATTACTCGCCAGTTTCTCAGGTATATATAT
TATCCTGAATGTTCTCTCCCAGGAGTATGGACCCTTAAAAGGCAAATCAATAATCTTAAT
ATAATGTTTTAATTGTTTTTCTTTTTCTACGTTTCTGAAAATTACGATTAATCCATTCTA
TTAAATTGTCAACTCTGCGTTATTCCTTCACCAAATTTGAATACGAATCAGACAATTCTA
AAATTACGTCATATTTTAACAACACATATCATAATATTCCACCAAAAGTCGCTTTTGATT
AATAAATGATACAGTATTTTTTTCCCAACGAACGGTCAGTAACATATCAGTAGACTCTAA
ACACATTTTGTATCAGTACACCTTCTTACACTGCTAAAATGTTTTGGTCTTTTTTTGTTT
ACATTAATATTTTCATTTACGCAACAGAGAATTGCCGCTAAATATGAACCAGCTACAAAC
AACTGGGTATGTATTAAATATAAGAATGCGAATTGATACCCTTATTACATAATTTTTTGA
TGCTCATCAGTATCAACAAATAGAATATAGCAAACGGAATTACCGGACATTCTAACATTT
CCTGGAGAATATCTGCTAGAGTCAAATCAAATGATGAAGACTTTCGGTTAGCGTTTCAGA
AATAAACAATGATGATTAATCCAAAAAATTTCGTATTTGAGAAGTAAGACAGTGAATCGA
AGTGGTTCTCCTATGGATTGTTTTAGACCCTGGGAACGTCACTGCGGTGTTTTCGCCCGT
CATACCAAGATGGGGCGGAGAACGGAAAATTTGATGGCGAATGTACACTGCCAAGGACAA
ACAGGGACGATAAAGTGTTAAAGTGGTGATATAGTCGGATCCGCGGTTAGCCGTAACCAT
TGCTTTCCAATGGTTTACGCCTGTAAAAAGAGCAACTTAGATAATTGTCGGCTTCACGTA
ATTAAGACGTATTAACTCAAAGGAAAAGAAAAGAGGGAAT
Chromosomal Coordinates Chr V from 248157-246982
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator