Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MEI4
Systematic Name YER044C-A
Description Meiosis-specific protein involved in double-strand break formation during meiotic recombination; required for chromosome synapsis and production of viable spores
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MEI4	6320884 upstream sequence, from -1000 to -1, size 1000
CATGGAAAAACGCTCAATTGAATGTGCATCCATGTACTCCAGCCTCTAATTCTTCCGTTT
CCTCTTCTTCTTCCTGCCAAAACATTAATGATCATAATATCGAAAATCAATCCGTCCATT
CTTCAATTTCCCATGGCGTTAATCACCACACTGTTAATAATTCCTGCCAAAATGCCGAGT
TGAATATTTCAAGCAGCCTTCCATACGAATCGAAATGCCCTGATGTCAATTTAACACATG
CCAACTCAAAACCACAATACAAGGATGCCACTTCTGCACTGAAAAACAATATTAATAGTG
AGAAAGACGTACATACCGCGCCCTTCTCCTCTATGCACACTACAGCAACCTTCCAAATAA
AGCAGGAAGCTAGACCCCAAAAAATAGAGAACAATACTGCAGGCTTGAAAGACGGTGCTA
AAGCTTGGAAGCGTGCAAGGCTACTAGAACGAAACAGAATTGCCGCTTCCAAGTGTCGAC
AGAGAAAGAAAATGTCACAATTACAACTTCAAAGGGAATTTGACCAAATAAGCAAAGAAA
ACACAATGATGAAGAAAAAAATTGAAAATTACGAAAAATTGGTTCAAAAAATGAAGAAAA
TTTCGAGGTTGCACATGCAAGAATGCACAATTAATGGTGGTAATAATAGTTATCAAAGCC
TTCAAAACAAGGATAGTGATGTTAACGGGTTTCTGAAAATGATTGAAGAAATGATACGCA
GCTCCAGTCTATATGATGAATAAAAGTATTGCGCATACTTCTTATGGGAGATCCAAATTC
CCAGTACATTAGTTTGACTCTCCTTCCTTAATGTTTTCCTCTGTACGATTATTTATGTTT
AAACGATTTATTTTACTATGTATGTATTTCCTTTCATTTTCTTTCGGAGTCATATATATT
GCTGGGCGGCTAAATGTTTCCGACTTGTAAAAGAAAACATAACAAACATCTTGTAGTTGT
GAAACAGTTTCATTAAATAATCTTTTAGAAGAGTAAGGAC
Chromosomal Coordinates Chr V from 239623-238460,239774-239712
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator