Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name VMA8
Systematic Name YEL051W
Description Subunit D of the eight-subunit V1 peripheral membrane domain of the vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; plays a role in the coupling of proton transport and ATP hydrolysis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VMA8	6320784 upstream sequence, from -1000 to -1, size 1000
TTCTTGAATTCGCCAACAGATTACCGTAAGATTCCAAGACCTGTGTCCTCAGTTTACTAT
TTCCCATCCGATACGAGCATAAAATACGCATCAAAGGAATGTAAAACCCGTCGAGAAACT
CATATTAAGGAATGGTATAACTATTTCGCACAGGCTTCCCACACCGATGATTCCACTGAT
TCACACACGGTGCATAAGACATTTTATGATTATCCATTAACTATTTGGGGGAGAGAGTTC
AAAGTCCCTAAGTGTACCCCACCTCGAGTCGCGCAGTTTACTTTCAAGCAGTTGTGTGGT
GAGCCTTTGGCCGCAGGAGATTACTTGACGTTGGCAAAAAATTTTGAAGCCTTTATAGTG
ACCGATATTCCATATTTGTCCATTTACGTTCGTGATGAAGTGAGAAGATTTATTACATTT
TTAGATGCTGTATATGACAGTGGCGGGAAACTGGCCACTACGGGTGCAGCGGATTTTTCT
TCCTTGTTTGTGGAACCTGAACAGATACTTAATGATTTTGAGTTACGCCCAACAACCAAA
GAACCTGATAGCGTCGATACTGGTATGGTAGATGAGATGGTTGAGAAACACGGTTTTTCG
AAAGAGATTGCCAAGAAATCGCAGATGTTTGCTCTTGATGAAGAAAGATTTGCCTTTGCC
CGTGCCTTAAGCAGGCTGTCACAGATGAGCTCCACCGATTGGGTTACTAAGCCTACATAC
TAAACCCTATGTAACAAAAGTGTTTATTTATATTCTTGTATTTATTCTAAACACGAACTT
TGATCGTCTAACAATTGCCGCAGTTACACCTTTAACAATAGTGCTTTTTATTACTGATAT
TACTCACCTGATTTTTTGTTACCCGAATGCAAATTTGATTAGGAACGGGGATTGTTAAAA
GACAATGGCAGTACAGATAAAGGTTAGATGAAGCAGCAGTAGAATAAATCAGCATCTGTA
GTACATAGGTTCCTAACAGCATTGTGAAAAAGGTTCAAAA
Chromosomal Coordinates Chr V from 58378-59148
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator