Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HYP2
Systematic Name YEL034W
Alias eIF-5A, eIF5A, TIF51A
Description Translation elongation factor eIF-5A that may function in translation initiation; similar to and functionally redundant with Anb1p; structural homolog of bacterial EF-P; undergoes an essential hypusination modification
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HYP2	6320801 upstream sequence, from -1000 to -1, size 1000
GCTGTCTCTACTAACAGATCTTGGCGTTTTTGAATCGTGTAGTTATTTTTATTTATTTTT
TTTATTTCATGTTTTCATGATTTCATCTTACGCAATTTTTTCACGATGAGACAAGGCGGG
CGACCCCACACAAGAGGAAAATTGAACACAATGCGTTGGTAAAGGGATTACGAATTGATT
AAACCAACATAGTGAGACAAGAAAAGAAAAGAAAAGAAAAGGAAAATGAAAAAAAATAAA
AAAAAGAAGGCAACTAGACCAGATGAGCCCGGTTCATTTCTATTCTCTGCAGTCACTGCT
ATTTTCATCAACAGCGCAGGCCAAGTTGAACGAGATAGTAGCAATCGTAAAAGGAACTAG
CTAACTTCATCATGAAAGTTTACCCTTTCTTGCCGCTACCCTTCTCGTTTGGCTGGTATT
AGAGCACAGCGGATATATCCGGCTCAACAGTATAAGTAACGATAAGTCCTGACCATTGGC
TTCGTTCTGGTGGCATTTTCTCTGAGGGGTGAGAACAGCAAAACGGGAACGGCGACTTGG
AGTAGTATAACGCTGTAGCTGGACGCTGAGGGGCCAAGGCCGGTAAAATTCTGCAACACC
CAGACCTTGCTGCAGTGATATCATCCACCCATACCCCTCGATGTATTCCGTAGCGTTATA
TCGGGTCCGTGTGAGGCGACAAGGGACCTCCCGCACCGCACATACCGCAGGAGCTAAAAG
AAACGCCGTCGCCCGAAAAAAAGTTTCGAAGGTGAAGGAACAGTGGTAATAAAAATTTTT
TTCGTCGTCGTCGTCGATCGGCTTTTGGCCGCGTTGATCGTCGTGTTCCACGATTATATA
ATGCACAAGGTTTTTGCCATATCTTGACATTGGAATCCCTCATTTCCTAAATTCCTCTCC
TTCTATCAATTGCTTCCTTTCCTTCTTTCTAACGATTCTACTTCTGTAGCCAATTACTCA
TAGACTCCCAAACACACACAAATACCAACTCATATATACA
Chromosomal Coordinates Chr V from 85676-86149
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator