Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GLC3
Systematic Name YEL011W
Alias GHA1
Description Glycogen branching enzyme, involved in glycogen accumulation; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm in a punctate pattern
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLC3	6320826 upstream sequence, from -1000 to -1, size 1000
AACATTGATATCGCATCGGGGTCCATATGTTTGGACGTAATTAACTCTACATGGTCGCCT
TTATATGATCTGATAAATATAGTGGAGTGGATGATACCAGGTTTATTAAAGGAGCCTAAT
GGTAGCGATCCCTTGAATAACGAAGCTGCCACATTGCAATTACGAGATAAAAAACTGTAT
GAGGAAAAAATCAAAGAGTATATAGACAAGTATGCTACAAAGGAAAAGTACCAACAAATG
TTTGGCGGAGATAATGATAGCGATGACAGTGATAGCGGCGGTGATTTACAAGAAGAGGAC
AGTGATTCTGATGAAGATATGGATGGCACTGGTGTTTCCAGTGGCGATGATAGCGTAGAT
GAGTTAAGCGAGGATCTAAGTGACATAGATGTCAGTGATGACGATGACTACGACGAAGTC
GCAAATCAATAATTTCGAGCACACACATATATATATATATATATATATGTATGTATGTAT
AAGTATATATGATGGCATACTATACCACACGTACGACTATAATTACAAACAACTATCAAG
CAACTACAAGGATCTCTGTGGGCTAGTGGCCTGCGGGCTCAATTTTGCTCTTGTTCCTGA
ACGGTGAATTCTGTAGTCTGTCATCCAGGGGAAGGGCAGGGCACTCATCAACAATGTGAT
AGTCAGAAAGCAATAATGTTTTGTATTCTGATGAGCTTTCACTATCTCTTCCGCAATACC
CCTTTTTGCCTATATTACGGCATCATCTTTCCCCGCGTTCTCGTGGGGGCCAAATAAGCT
TTGTCCAAGGGGCTGTTGCAACGGTAAAGGTAGTCGAGCCAAGTGACACCAGCAAACAAG
GAAACAAGGAAGCAAGGAAGGCTTTCCATTTTCCAATAACGACATGAGTCTATCTATGGT
GTATAAAAGTGGCAGGCTTTTCCTACATTTTTTTTCCCTGATAACTTCCTGTTACTATTT
AAGAACACCAAACCAAGTATAAAGAACCGTCAAGAATAAA
Chromosomal Coordinates Chr V from 133120-135234
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator