Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NPL3
Systematic Name YDR432W
Alias MTR13, MTS1, NAB1, NOP3
Description RNA-binding protein that promotes elongation, regulates termination, and carries poly(A) mRNA from nucleus to cytoplasm; required for pre-mRNA splicing; dissociation from mRNAs promoted by Mtr10p; phosphorylated by Sky1p in the cytoplasm
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NPL3	6320640 upstream sequence, from -1000 to -1, size 1000
AATCCAAGAGATCGCCGTATCTCAAGTCTGTAATTTTCATAGGATCTCCGCCGGAGTTAT
TCAGGGAAGGATAAATAGACTGTTGAAATTTACTCCAGAAATAGTAATTGGCATTTGATA
TTTGACCTTTCATTTCGTTATAGACAACACCTTTGAAAACAATGTTACTCTCCGGGTCTG
TGATGTTTTTATGCTCCAACCTCCAACCCTCCTGATCAAAATCTTCTTGTTTAAGTAGCG
GATTCAAGGTGGAGTCTAAATAAACACCTCTTAAATTAGCGAAATCTTGAGGGTTCGTAG
TGGAAAAGGGAAAAAATGTATAATCTGGACCTGTCATAGCGTTCATGAAATTAGCTAGAG
ATTTATTTAGCATTTTGAAAAAAGGGTCCCTAACTGGATATTTAACAGACCCACACAACG
TTGTATGCTCTAGAATATGAGGGACCCCAGTGGAATCTGGAGGGTTGGTTTTAAAAGCAA
TGCTGAACACATTATTCTTGTCGTCTCTATCAATATGCAAATGCTCGGCTCCTGTCTGGG
AGTGCACCAAATCTACCGCAGTGAGTCTCAGCTCCGGAACCGGTAGAATTCTTCTCACTT
CATAACCATGGAATATACCTCCAACTGGATATTTTCTAACGGCCTGTGCTTGGGCATACG
AGGACGCAAATCGCTGAAACCGCAACATATATACCGCAGTATATTTTATAGTAACTTTAT
TCTTTTGAGTAGCCTTCTAATTGGTGGCTTATTGATTACAATTGCTTGTTATCATATCTG
TCAATGCTTGTTCAACAATTCAATGATTTACTACTACCTTTATCATAGAGCCCCTCCGTA
TATTTATCACTGTAAACGAAGGGCAAAATTTTTTACATTCTTTTTTTTCGCCACCCAAAG
GGATTTAAAAAGGACATGAGAAAAATAATTTCCTCTCTTCTAAATATATATACTTTTGAA
GGAATCAAAATTAAGCAATTACGCTAAAACCATAAGGATA
Chromosomal Coordinates Chr IV from 1328783-1330027
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator