Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name REF2
Systematic Name YDR195W
Description RNA-binding protein involved in the cleavage step of mRNA 3'-end formation prior to polyadenylation, and in snoRNA maturation; part of holo-CPF subcomplex APT, which associates with 3'-ends of snoRNA- and mRNA-encoding genes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>REF2	6320401 upstream sequence, from -1000 to -1, size 1000
TTCTTTATCAAGGACTCCTTCCTCCAGTAAAGAGTCCAGCGTTACTTCTTTACTATTATC
TTCTTTTGGGACGTGAATTAGTTTGGAAAAAGTGGTCTTATCAAAGTGCACTTCATCATC
GTCTTCTCTAGACCTTGTCCTTGGGCGAGAATTGAAACGGGAGTTTCTATACCTGTTACT
GTTGTTGTTTCTCTGATTCCTACCAAAATTTCTTTGATCTCTGTTTCCATCATTGTATAA
TCTTCTTGAAACAGCCCAAGTAATATGGTTGCAATTCGAGAGAGCTGCTAATAAATTTCT
GCTTGCAAGAACAGGTGTGCGACCTTTTATCAATATAGAGGTCAACATTTATCAGCCTAA
CGTGCAACTCTGGTATTTTCTTGCCACTCTGAGACACCATAGTGGCCATCAATACTTCCC
TTCTTTTTATAGGAAAATTTTATTCTTTCTATAATATCACTACAGACGGAGAATGAAACA
GATGATGATTGAAGCATCCATAAGTAAAGACACTTTGAGGTTGCTAATTTGCTTTTTTGA
AATAAAACAGTGCCATATATCACTCCAGCCTACTTGTTATTATCAGAATTGGGTACGGTA
TTCATCTATATATTACCAGTTGTAAATCACGATATATCACGATACACGACTCTCCGGCGC
CAGCGTTTTTCGTCAGTTTTTCTCAAGGCGGTATAAAAAATCGATGATATTCGATTGAGG
CACTTGTTAACAAGCATACACTGTTGGAGGCAGAACAAAACAAGCATAACTCTTTTGTAC
TGTATTGTACTCTACCGCTCTGTATCACGTCGGCACACCAACGGTTTCTTTTGGCGGGTC
TATTATATATATTATATATACTTTTATCAAGACATCGTGTGAGTAAGTGAGGTTAAAGCT
CAAAAACCTACAAGCAAAGGCACAAGGAAATCGAAAGGACCAAGAAAGGAAAAGAAAAGA
AACGATACGATAAGTAAAGACACTGTGGAAGAATTGAACA
Chromosomal Coordinates Chr IV from 848599-850200
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator