Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PPH3
Systematic Name YDR075W
Description Catalytic subunit of protein phosphatase PP4 complex; active complex is composed of Pph3p and Psy2p, with Psy4p apparently providing additional substrate specificity in some cases; regulates recovery from the DNA damage checkpoint and also the gene conversion- and single-strand annealing-mediated pathways of meiotic double-strand break repair; involved in activation of Gln3p to alleviate nitrogen catabolite repression; Pph3p and Psy2p localize to foci on meiotic chromosomes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PPH3	6320280 upstream sequence, from -1000 to -1, size 1000
AACCACAGGACATGTTGAAGGGAATCAGTGAAAAACTACCTAAGGATGAAATGCCTGATT
TTGTATTATGTTTGGGTGATGACTTCACTGACGAAGACATGTTTAGACAGTTGAATACCA
TTGAAACTTGTTGGAAAGAAAAATATCCTGACCAAAAAAATCAATGGGGCAACTACGGAT
TCTATCCTGTCACTGTGGGATCTGCATCCAAGAAAACTGTCGCAAAGGCTCATTTAACCG
ATCCTCAGCAAGTCCTGGAGACTTTAGGTTTACTTGTTGGTGATGTCTCTCTCTTCCAAA
GTGCTGGTACGGTCGACCTGGATTCCAGAGGTCATGTCAAGAATAGTGAGAGCAGTTTGA
AATCAAAGCTAGCATCTAAAGCTTATGTTATGAAAAGATCGGCTTCTTACACCGGCGCAA
AGGTTTGAAACACCCTTTTTAACGAAATGGTTATGACTAGACAGACATCTTACGTCTTAC
TCCTTCATGCTTTATTTTTTTCTTTGTATTGTATTTGAACAGTCAATATGTGGTGTTGCG
ACGAAGGCATATATATAATAGTCTCAACCCACCATTTTCGAAGATTTACATACACATTAT
ATTTTTATAAACTTCCAATATGTAATAACTTTATATGATATGTAACTTCTCACTATTATC
CTTACTATTAAACGGTTTTTAATAAATATCATTGTTCTTTGTTTTATTAATGAGAAAAAG
AAATTTAATACAATGTCCGGCGGGAAGAAAAAAAATCGATGAATTAATTGAAAAAAAGTA
TCTTTATCATGTGAACTGAGGAGAAGAACGGCATCTCGAAAAGAGCACGTCGAAACAGCG
GTAGGTAAAAGAGGGTACTACCAGAGGTCTTTTCTCTTTATACGTTAACCTCTCAGCTTT
TTCTTTTGCAATTCAGGACACTTTAACTTGTAGTCACACGCTAGTCCACGTAGCAAAGTA
AAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGAT
Chromosomal Coordinates Chr IV from 597156-598082
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator