Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SNF11
Systematic Name YDR073W
Description Subunit of the SWI/SNF chromatin remodeling complex involved in transcriptional regulation; interacts with a highly conserved 40-residue sequence of Snf2p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNF11	6320278 upstream sequence, from -1000 to -1, size 1000
AAAGTAGCGATGCTTATGAAAACACTATGCCTTAGGTTTCCTTTTTTTATTTTTATTTGA
CAAGTAGCGATTACTCTTCTATTGTTCCTGGTTTTTGATGCTCGAATGTATTATATAAAA
ATGTTGTGGCCGGAGGTCTGCATTTCTAGGCATTTTTCCTTTTTCTTATTTTTTTTACTT
TCCTACTAACTTTGCACTTCGTAAGAGAATTTACACCAGAACTCTCGATTGAGGCGAAGA
AGGCGGAGAAAAAAGCCGGTAAAAAAAAAAAGCGGAATCAATCAGCACAATCAGAGGCGT
CAAGAAGCGGCGCGGGGATAATGCTTTTTTCCCGTGGCGTTCACATTTTTGTTCCGCGGA
AAGCACGTGAGCGTAATCCACTCGGGAAGGGCGCAGCTGCCGTGGCCAACTGAAGTAATC
TTTAGCCGTTTATCGCCGCGCAAAACGGCAATTGCACTTGAGACCCCAACGGCGCTGTGC
AGCAGGGTATTCTACTACGTGTTAGCTTGCCTTGCATTTCCCCATGCGTCTCGAATAGGA
ATTATTCAAGATGGATTATTGGCATTTACGAGTAACCAAGGATAACCCCGCTGTGCGTGA
AACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTGCAAACGCGAATAAACATATCTACGC
TATATATAGATATGACGTTTCTCAAGCCAACAGAAGTAGATAAAGCAGCCAGGAGGGTAG
AGAGTGTTCAAATTATAGCAAGCCTTCTTCTACCTGTTTTTTTTTGATGATTGTTTTGCC
GGGTAACAATCGACTTTCGGGCAAATTTTTTTTCCTTTTTTCTCCTAACAGTATATACGG
AGTGGAGAACAGACTTCCCATAAAAGCATATTACGTGGGGTCGTAGTAAGATTGCCGTTT
ATGATACCCTCTATTCAGGGCTCAGAGCGCATCACGATCGGGAGTGTAAATTCAATGTGC
ATATAAGCAAAACACACAGATTTCCTTTTTTCCCAGAAAA
Chromosomal Coordinates Chr IV from 592439-592948
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator