Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DOA4
Systematic Name YDR069C
Alias DOS1, MUT4, NPI2, SSV7, UBP4
Description Ubiquitin isopeptidase, required for recycling ubiquitin from proteasome-bound ubiquitinated intermediates, acts at the late endosome/prevacuolar compartment to recover ubiquitin from ubiquitinated membrane proteins en route to the vacuole
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DOA4	6320274 upstream sequence, from -1000 to -1, size 1000
CCCTACATCCTTGACCGTACTGAGATATCACTGCTTAATTCCGGTGATTGGGTTCTTTTC
AGTTCTTGGAGAGATATACGTACTACCTTCCTTTTTTTTTAAGGATACCTTTACTGTAAA
GGGTTTGTTCCTGTATCAACCCCTTCTTCCTGTACAGAATCTAAGGGAACCGTAAAAGCA
CATAAGTATATAAAGGTCCCAAGATTTGATTAGGTAGATATGGCCTTTGAGTTGGCTCTT
AGTTTTTTTTGGCCTTGAATACTTGTTCCTACAATACTCCAACAGCAGTTGAAGCCAGAC
CGCAGTATCACATATATAATACACAGGAATATATTTGATAATGTTGAGAACCACTTTTTT
GCGCACTCCAAGACAATTGATGCGTAAATCGCCAAGGGCGTCTTTCTCAATCGTCACTAG
GGCCGCCTTTCCTCACCTAAAGAACAATCAAGATGAAGCTGAGAAAAAAGAACAGGGTTT
GTTTGATAGCAACAAGAAGAGGTTGGACACTTTGGAACACGGCAAGAATCCAGATTATAA
GCAACCTGGAATGGAAGATTTGAAAAAAAAGGGAGATGACGCTAGAATCGAACAAAACAG
GCCAGATGACGGTGTTTATTAAGAAGCACTTGGTACAAACTCGTATATGCATGTAGTTTC
TGTCATACACATATCTATATTCCTTCCCCCCTGGTCCTATCGTATTTAGTCATATCATAT
CATTTATTGATATCTATATAAGTGCAAAACTATAACCATTATTTATTTGCTTTCCACATT
GTTTTACTTCATTTGCTTCAATATCGTTCATTACGTTTAGCGAATGGCTAAGGCCCTTGT
ATTAGTAAAAGCCTAGAAAAAAAAAAAAAAAAAAAAAAAAGGATATGATGTTATATGATA
CGTGTAGTTCATGTATTTATCTTCGGTAGTATAGGGCAGATTTAAGACTGAGTGTGCACG
CTTCCAAAGTTTTTTTTACTATTTGATACATGCTTAAGTT
Chromosomal Coordinates Chr IV from 587719-584939
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator