Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name UBC5
Systematic Name YDR059C
Description Ubiquitin-conjugating enzyme that mediates selective degradation of short-lived, abnormal, or excess proteins, including histone H3; central component of the cellular stress response; expression is heat inducible
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UBC5	6320264 upstream sequence, from -1000 to -1, size 1000
GGCCTTCACGTCCTTGCCTTTGTGGGTTTTCTTCGCCTTTTTGCTGTTATTGTCTCGCAA
TTTTGACGAAATCTTATTTCTTAGTGAAGACAAATCCAGCGGATTGCCGTTGTTCTCACT
CATTATTTTTGATTACTGTACCAACAAAGACACTGGAGAGGTTTAATATCTATAGAAATT
TATCAAACTATAGAATTTCGCTTCCGATGTGTACGACATAATGCTTTCTTATTCGCAACT
CCATTACTTTGGCATCTCTGATAATTTTTTACCTCATCGCCAAAAGAAAAAATTTTTCAT
TCTGCAACGGGTAACGGAATACAGAGGCAAGAGAACGGAAGAACATCATATCGGCGGTTA
TTACTAAACAGTATATGTCCAATCGGTTTTGGAAATGAGATTTTCTTATTAATGATCTGA
TCTTAGATTATGTTGGGCAATACGCGTTATACAAAAGATCTGCTATTGCATGTGGTGAAA
GTTATACCAACATTTTTGCTTATATGAAATCATCTGCAACAACCAATTGGATAAGGATAG
ATTTCTCAAATATATTAAATTATGTCTTGGTTTACTTACACAGAAAGTCCCAAAGTACAG
ATGAATTATACTAGGGTTGTGTTCATTGTTCCATGAGAGGCTGTACTTTTTGCCTACTTA
TTTTGGTACTCATTCATTAGGCTCATAAACCGATTTTTCTTATATTGTGCGTAATTCAAT
TAGATATCTAGATGTATTGCTAGTGCTAGTACGGTGTAAACTCTCGTAGCAAGCGTTTTG
AAGCATGGCTGTGGTGGAGGTAGTTGCCACTGCGAGCGGGTAATAAAGCGGCTGCCGCCT
TACTCATTTGTACCAAAGATAGCCGACCCAAAATTATAAAAAATAATTGTATCCCGGATT
TTAATAGATGGTTGGAGTTTTATTTTCCAAGGTCAGGACTGCTTATTGACTACCATCTTG
AAAAGTCATTTTCTGCTCACCACCCTCAACTAAACTAAAA
Chromosomal Coordinates Chr IV from 569633-569234,569770-569724
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator