Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ENA1
Systematic Name YDR040C
Alias HOR6, PMR2
Description P-type ATPase sodium pump, involved in Na+ and Li+ efflux to allow salt tolerance
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ENA1	6320245 upstream sequence, from -1000 to -1, size 1000
GTCAATATTTTAGGGTTATCGGTGAACGATAACAAAATCCGTAATTGTTTCCTACGCTGG
TTATTACTAAGTAGCCACTCGGTGGCTATCTCTAGCCGTTCATCAATCATGTCAAAAGTA
CAATCACTGAGCTTATTAAGTCATCCGCACGTGGAACTCACACAAGCCCCGAATTTTGTC
AGCCATTCCGTGGAAAATCCTTTATCTCGTCACTCTTGTACGGAAGTTGCACCTTTAGCC
CCACTCCCAGATCTTCAATCACAGAGGCAATGAGGGTGGCTGTGCAATGTAAACTTTCTT
ATCGCTTCCTGTTATGATTGATTACCATGCGCGGTAGAAGGATTGAATGAGGGGTGTGGG
TGTGATAATTCATGTACGGACCCTTTCCTCCCAGAAGCTTCTGCACGAAGTGGTTACATT
GTGAGTACAGGGTCTTAAACATCGCCGTGCGGCGTCATTTTGCGGGGCTCATCATTTATT
TCCTACTTCTATGACGTTTGTTAGGGCAGGGATGTAGATTTTGGTCATATACTTTCACCT
GACAGAAGAAAAAACAAGGTCTTAGAGCAGTATTCCCGAATTATTGCCTCTTTCCTTGGT
GGGTGCGGGTTAATATTAGATGAACGGTGGGTTGTGGTCAAACCCGGGGTAGGTTTTAAA
ATGTCATGCGTTTTCGTCATTTACATAGATATATACAGGGAAAATATATATATATATATA
TATATATATATATACCTAAGGGAAACAATTTGAATAGATAAAAGGTCTTTTCCTCTTATT
CCGTTCTTTCTTTTTAGAGTACTATTAATTTCTACTATTTCTCCTATCTTTCTTTTCTCA
TTAGTAATAGTCTAATCATTTATATTCTAATATTAACTTTAATAAAGCAGATATCTTCAT
CAAGTGAACTGTTCACACTTAATTCACATTTATTTGAGGCAACAATACGTATATTTACTA
ATTAAAGAAAAAACTTCGTACACAGAATTGAAAATTTTCG
Chromosomal Coordinates Chr IV from 538467-535192
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator