Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CWC2
Systematic Name YDL209C
Alias NTC40
Description Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; binds directly to U6 snRNA; similar to S. pombe Cwf2
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CWC2	6319992 upstream sequence, from -1000 to -1, size 1000
CTGTAGCAACGGCCCGCGATTCTCTTGTTATCAATTATATACCTATTTCTTTGATGATAT
TTTCATTAAACATACAAAAAGTGGAACAGTAGAACGAAGCCCGGTTACCCGAAAAGTCAC
AAACATTTGATGTTATTAGTAGTATTATATAATATACAGAAGGCCTACAGTCAAAATATA
TATCTAATGCCAGATTTTTTTTATTTCTTCTAGATTTCTAATATGGTTAAGAAGCGAACT
TTTTTCATAAAGCTTGAACTTCTTTGACAACTTCGTTGAAAGATTCCTTGTATTCTTCTT
CTTTATTTTTTCCATCTTTTTTCTTATTGCTACCTGGGACGATAAAGACAACTGAGGTAG
GTCTTTTTGTAGCGCCAGCGGCACCTAAGTCTTGCTTTGAAGGTATGAAGATGTATGGGA
CAGAGTGATCTTCACATAAGACTGGGATGTGGGAAATAACATCAGCTGGAGAAATGTCAC
CGGCGATGACGACTAAACCTTTTTCACCCTTTCTTAAGGCCTTGACAACTTCCTTGACAC
CTCTTTTAACATTCTTGGCCTTGGAAGCCTTCTTCACGGTCTTCAAGACCTTCTTGTTTA
GTTTCTTAGAGGCCAATGGTTTAGCGAATGGCAACACAGCAGGCATTCTGGCCTCATAGT
TGTCTACGGTTTTGCTTTCTTTGCTTTCCTTATGTTCCTTGTTGTCTTTACCCATTTTTA
CTGCACTTGTTTCCGTTTCTCTGCTACCCAATGATCCATTGACCATTTACTACTACTATA
TCATGCATTCGTTTTTTACTTTTCTTTATTCCTCATCACTTTTTTTCAGAAAAATTTTTT
TCAGTTTTTGAGCATTCCATCGTTACATACGTACATATGCGGGTAATGATGAAATTTTCC
ATTATGTATTGAAGGCTGGATCATAATAAAGACTACTGGCGATGGGCCTTAAGGTAGTAA
CGACGTTAGTAAGACAGTATACGCATTGATAGAAATTTGG
Chromosomal Coordinates Chr IV from 87226-86207
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator