Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RGT2
Systematic Name YDL138W
Description Plasma membrane high glucose sensor that regulates glucose transport; contains 12 predicted transmembrane segments and a long C-terminal tail required for induction of hexose transporters; highly similar to Snf3p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RGT2	6320063 upstream sequence, from -1000 to -1, size 1000
CTTAAAATAATAATAGCCCATTCTTGGACTGAGGTACATTTTCTTCTTATTGGATTTCGT
TTATTAGCTGTTTAACATATTTCTGTAGGGTTTTTTTTTTTTTTTTTGTACAGATTAGAA
ACCATACAGTGTAAACCATTATATAGGTCAATTAATATATTTATAGATCATCCTGTCAAT
TTTTTTTTATTTTTTTTTGCAAAGCTCCCTTTTTCCTGAAACCAACAACAAAATATAAAA
AAAAAATGATAAGCAGGATTTTTTCTTTTAATAATTCCTTAAAATTAACTAACAAGCTGA
AGCCCTTACAACAAAGTAAGTCAAACCCAATTCACAAAAAAAAAATCTGTTTTATTTCAG
ATATGCAGGGTATATACATGGCACAGATAACCTTTTAATGAAAAGTAGCAATTGTGATAC
TAGCGCCTTTTTCCTTGCAAGAAAAGGGTTCCCTGTTCCTGCATCGTCCATCGGCATAGA
GATGTCGCCGCTACCCTATCCAATTCTACCGCATGCCTAACAAAATGATTTCCGATTTTT
TCAATCTAACTCCGTCATTTCTTATCTGAGTTTTCCTCCCCGAGATAAATTGAACAAAGA
ATTTAATCGGCTCATATGTGAAAAAGTGTGATACTTACCGCAATGGGCAAAAATTATTAA
AAAAAATCTAATTCCGCGCTTGGCTATTATCTCATTACCGACTCAACGGTGACTACCTGC
CGTACACGCTTCCCCTTTGCTTCTTCCTCCACCTCGAAAGTAGAACATATACATGGAACA
GACATAAGCTCTTCAGCGTATCTATTTCATAAGTGGAGAGCATCGAACAATAAACCTTTG
CCTAATTTCATATAACATCCAGTATTCATTTTTTTTAGTTGACGCTAAGGCATTCGCTTG
TGAAATTAAAGAGCAGATCAGGAATAGTATCAATAGTCTAAACCATCAAGTTGCACAGAA
ACCACTATATATATATGGAAATATCTCGAATATTGCTTGT
Chromosomal Coordinates Chr IV from 213351-215642
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator