Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PMT1
Systematic Name YDL095W
Description Protein O-mannosyltransferase, transfers mannose from dolichyl phosphate-D-mannose to protein Ser/Thr residues; 1 of 7 related proteins involved in O-glycosylation which is essential for cell wall rigidity; involved in ER quality control
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PMT1	6320107 upstream sequence, from -1000 to -1, size 1000
GTGTAGGACAGTATATGGAGTTAGCGGCCGTCCTTGCTGCAGTCAACGAGGCCTTGGACT
TGGCTAGATTCCTCAGTTTATGGTAAACTTTACTTTCCAATAGATGTACATCAACCAAAG
AGGGCTTGTCGTCCAGCTTTTTGAACTCCCTCAAAAGATCGTTAATCAATGCTAATGAGT
CCTTGTACTGTTTCTTTTGATAATGTAAGGTGGCCAATTTGATCGAGAGTGAATGCTTCA
AAAACACCCTTTTTTCTCTCTTGGCAAATTCGATGCTTTTCTCGCACACAAAGATCTGAT
CGTCCAAGGAGTCCGGCACTTGCTCGAATTTTTCAATCAACGTTTTCAATACCTTTACCG
TTTTGGATTTGGCAAATTGCATCATATACTCCGTAGAATGAGGAATAAACTCGCGCAATT
TGTCCTTTGCACCCATAGTCACGTATAACTGTCCTAATTCCAATATGCTTGTCTCCTGTT
CATTTCTACGCTTGTCATCCACACTGGCACCGGCAGCGGCGCTGCTCTGTGAGCTGTCTT
TATCCAGCAGGCTCAAATAGACTTGTTCTGCCTCATTATACTGTTTTTCATTAACCAGTC
TCCTGGCCTCTTCTAATTTCGAACCTGGCAGAGACATGAAGTTCCTCGTTTATAGATTAA
TCACCAATTGTCCTCTTTCAGCGCTTCTGTTAGTTGGCCTTATTTAACGGATCTTTGCTT
CAATTACGCTTTCTACCAACATTTGCCACCCTTGGAACCAGAAGAGAATATACATCATTC
GGGGTTGCCCTGCCCATTTATATCGTATATTGTGATGATATACCTTTTTTTTTTTTTTCG
CTGCGTTTTTTTTCTCGACACGTGTCGAAGAAGAGTTTGGCGTTTCTAAGCAGATCTTGA
TTATTTTCGAGCAGCAAAACAAGACAAACAGGTGCATTGTTAAAGCGAGGTAGTATCAGA
AGAGCCTATCAAGAAACAGCTAACAGCTACAAGCACGGTC
Chromosomal Coordinates Chr IV from 287059-289512
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator