Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SED4
Systematic Name YCR067C
Description Integral endoplasmic reticulum membrane protein that stimulates Sar1p GTPase activity; involved in COPII vesicle budding through disassociation of coat proteins from membranes onto liposomes; binds Sec16p; similar to Sec12p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SED4	6319912 upstream sequence, from -1000 to -1, size 1000
CCGGTAAAGCAAAGTAGTAAGCAATAAGGCAGAGCACTGTAAGCGTTAGAATGCATCCTA
GATGCAAAGGAGAAGCAAATCTCTTTCTTGAAGGGCTTTTATGCAACATTCAATAGAATA
TTTCCCTTGTTTCCTTTAATTGTAATGCCTAGATCAGTTCTCAATCACGATAACAATTTT
CTGAGCAGCGGCGTACTTTCTTTGACTTATCCAAAAGGTTGACACTGATTTGAGTGTCTC
AAAAGCCTTTAAATGATAGAAACAAGGCTTTTAGGCTAGTCTTATGTAATAGAGAAAGTT
CATCTATATCTACAGATTCTTATTATGTACTGTTGAACAAAGGTGCGGGTAACTGCGATC
ACACAATCACTTTTTTCCGGAAACGGCTGTCTTCAGCGAACAACAATATAGTAGAGATAC
TGTATTCAACTGGAAATGCTTTCCCTTTTGCCCTATCATTATTTTCTTTCCGATGTTATG
CTTATTATATCTGTGATTGATAAGAGAAAAAAAAAAAAGTGACAGCTATAGAGAAAAAAA
AAAACCCTTAGAGAATCCTACCTGGAATATATTTAATGAGCAAGTCTATCTGCTGCACAT
TGGTCACGACACATGTTAGTGTATATGGCCCAGCCTATGTATTTACGATTTAAATCACCT
TGATAATTATTAAACGATATCCAGTTTATTTCGTATTATGTTACATCTGTCAAGCCCTTA
CTTAGCAATTTTGAGCCCTAGTATTTTTGACCACATTTGTAACTGCCCTATTTTATTATC
CTTTTAGCCCTCCTGTCCTTTTTTCTTGGTTGTAGTAATTTTCATTTATATCTCGAGAAT
TGTACAGTGTAAATGAGAACTGTGAACGCTTCAAGTAACCTACGCTTATAGCTGCTTCGA
TCGACGGAGGCTGTTTGTCAACAAGCATCACAATTCCCTACGATACGTCCTCTCTTCCTT
TTTTTTCTCTCCTTTTAAACTTAGAAAAACTAGCATAATA
Chromosomal Coordinates Chr III from 236322-233125
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator