Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HSP30
Systematic Name YCR021C
Alias YRO1
Description Hydrophobic plasma membrane localized, stress-responsive protein that negatively regulates the H(+)-ATPase Pma1p; induced by heat shock, ethanol treatment, weak organic acid, glucose limitation, and entry into stationary phase
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP30	6319869 upstream sequence, from -1000 to -1, size 1000
AAAGTAGAAAACTTGAGCACTTATTTCCTGCGCATGTCATATGTTAATTTTCCTCAACTG
CGCTGAATACGTCCTGTCAATTCAAATATATCACGTTGTGAGCAGCCCTGAAGAAGAAAA
CCTCAACAGCAGTATTACTATTACAATCAAACAACTTTAGTGCCGCGTGATACCGGGGGT
TGAAGTGGGTGCATTGAGCCGTATTCTTCTTCCCCGTAAGAAAGTTGTGTATCCTTTTTA
CTGCGTTGTAATAGCTTCTGAAAACCTAAAAAATGAACGCTATGTAGCTCATATCCGTTT
TGCATAAGTAAGAATAACTACTTGTGCAGGGTGCCGAAAGGGATGGAAAACCGCTGCAGC
AACCCTTGTTACATACAGTCGGATCCATCTGACTTACTTTCCTTGCGTCTCCCTGCGCGA
TTTTGTTGGCCATTTTCCAGATCCTCTAGAATTTTTCAAGGGTCGAGCCGTAGGAGGATT
CTCTCAGAAGGCAAAAACGCATCGAAAGCGTGCTTTGTAAGAATATTTGGTATGGCTAAA
GTAAGCAAAGCCATATCCCGATCCCGATCCCGACTCTTATTCCGATCCCTTCCGCCACAT
CCTGCATGTTTATTCGAATACCAAATTAGCTCATCTTCGTTATTTCATCATCCCTTTCTG
CTATGGCAAGGACAAGTTTTTTTCTAGCATCTCATCGAAAACTTTCCTCTCCCTAATTGG
CCAAAGTTTTCATATTCATCATCAGTTAGAAAGTATAATATCAATCCCTTACCTCATTAC
AAGTTGTATCACACTAAAAAAATCATATATAAGTCTGTGAGAGTCTTCAATTATTTAGCG
TAACACCTATTCACTTTCTAATCTTGTTTCTTGTTTTTACATTCTGCAATACAACACAAC
AACAAATATTAACTCAATTATTATTATTTATAATTACAAAAACAAAACAACAAGTTTGAG
ACTTTAATATCTTTTGATTACTAAAAACAACAAATTTCAA
Chromosomal Coordinates Chr III from 157107-156109
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator