Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALG7
Systematic Name YBR243C
Alias TUR1
Description UDP-N-acetyl-glucosamine-1-P transferase, transfers Glc-Nac-P from UDP-GlcNac to Dol-P in the ER in the first step of the dolichol pathway of protein asparagine-linked glycosylation; inhibited by tunicamycin
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALG7	6319720 upstream sequence, from -1000 to -1, size 1000
ACGCCATAATTCAACTGGCAAAATTCCGTAATTTGTTCATCAGAGCCCGGTTCCTGCTTC
CCGAACTGATTACATGGGAACCCCAAAATAACAAACCCCTTATCTTGATATTTTTTGTAT
AGTTCTTCCAATTCTTTATACTGCGGCGTGAAGCCGCACTTGGAGGCAACATTAACTATG
AGAACTACTTTGCCTTTCAGTTGGTCAAACTTAAAAGATTCGCCTTTCTTGTCCTTGCAT
TCTAAATCATAAAAAGATGTGGTCATTTTGAATTATTACTTTTTGTTGCTAATTGTATTC
TTGTCAAGGTCAGCCATGCAGGGAAATGCAAGTTCTCTGCGCTACATCACATATTAGCAA
ATAGTAGTTCTTTATATATCAAAACAATAACAAAAGTACCTGCACATTTTTTAAAGCAGG
CTGGCTTAGGGGCTTTGCACTAATACGGAGACAATGGAACTAATGCCTTTCACGATATGT
GTGGCAGATATTGTGGTTTTAAACTCTTTGTCATCGGAATTACTAATTGTCTAGATATGG
CCGGCCGAGTAGCCTCTAAAAAATATTAAACAGTTGAAAGTAAAATTGCTTGGAAAACAC
TACTGAGTCGTTGGTCATTTCAAGAGACTGCATCTATCAAAAATAGTCAAGATTTGTGTA
CATGTTCGTCGTACATTTAGTAAGTAACGTCCGTATTTTCCTTTTTTTAGCGGATGATGA
GTAAAAAATTTCTTGTGGATTTATATGTTACGAATACAAACACAGAGGTTGATGCATGAA
TTTTTTCTAGCTACTACCATGTGTTTAATACAATAATAGTACAGGTTTCCTTCATCTCCT
GTATATGGCCCTTTCCTTTTATATTGCCTCAATCTCGAAAAATGCTTTACTAAACAGCGC
GAAAATTAAATTGTTAACATGTGTATATAACTGTGAAATATGTAAATAAAAACTTTATCA
AGTAGAGCAAGGCGGAGAACGGTAACAAAAAGTAGACTAT
Chromosomal Coordinates Chr II from 706793-705447
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator