Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS6b
Systematic Name YBR181C
Alias LPG18, RPS101, RPS102
Description Protein component of the small (40S) ribosomal subunit; identical to Rps6Ap and has similarity to rat S6 ribosomal protein
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS6B	6319658 upstream sequence, from -1000 to -1, size 1000
CCACTCCCAATCAAATGCTCGCCAGCAACATGTCCTCCCCTCTTTCTCGTTCAAAGTTTT
TGGGATTCAAGAACAATGATATGGACGACTTATATCATAATGGCCGATGTGGCAGCACTT
ATGTAAATAACAAAACATTCTTTCTGAAACCGCCAATTGGAAGACCGCCTAAATTTCCGA
AAAGCCCGTCTTCATCTATTGTGGTTTTTCCTTCCTCGGTAGCTAGTTCAACTTTGAAAT
CCACGAGTTCGACAAACTCTCCAGATTAATGAATCGCTTTCTAGCTACTTTTTACTACAA
GAAAGCATTCGCTTAAAATTAAGAGTGTATGTTGGCGCATTTAGGCAAACGTCTTCTAAA
TTAGGGCTATAGACAATTATGTCGCTCGTACATTTTTCAGATGTAGTGACGCAAATTTCT
AGCAATTTGCAGGTAGTGCTCCACGGCCCCCTTCCAATTTTTGTGCACTCAATCGATCAA
AACAATAGAGACTGCCCTGTTAACTTCTCAACATAATTATGTAAAAAATTATCTCATTAA
GCCAGATAGCAAATATATCACATATTGCATTGATTAATTTGAGAAAAATATACATGTATC
TTTTCAGTTAATTTTATTAAAAATAAATTATTTCCTTACTTTTTTTTCTACAGTTTGCAC
CATTAACCTCTTTTCTTGCATCCATACATCTTTGAACTCCATACATCTTATTTTTTTGCT
GTTTTTTTTCAGTGTCTCGGGCATACAGGCCGCTTATCTTCATGCCGGCCCATCATCCTA
GGAAACTCTTTCGGTATGGGCCAAGGGCAGGCGAAAATCCTATGTGCGTGGAGCTGATAC
AATCTCGGCTGGCTTGGTTTGTAGGGCACGGTCAATGAATGCCTGATGGGAGAAAAATTC
ATCTTTATGAAAAGTGATCTTAATTTGAATAGTGTGCCCTTCAAAACATTTGGAAGTCAT
TAATTGAAACTATCCAGTGTGAATAGACGACTGAGCCATC
Chromosomal Coordinates Chr II from 592416-591712,592774-592769
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator