Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CKS1
Systematic Name YBR135W
Description Cyclin-dependent protein kinase regulatory subunit and adaptor; modulates proteolysis of M-phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CKS1	6319611 upstream sequence, from -1000 to -1, size 1000
GGCGCCAATATTAGCTTATTGATTCCAACAAACCTCGCGTACTTACATTCGTTTAGAAGG
ACCTTTAAGCCAAGATCTCTTACATTTGGATCGCGACTCTCCAGCTCCAGCCAAGAGGAT
AACAGCCCTATGTAAGACGGCGTATCGTCATTGTCTAGCTTCTTGACGTTGAACGGGGGT
ATACAGATATCCTGCAACTGCGGTTCAGGAATTTGAAGCGGTTTCCAGTTCTGTATGGAT
TGTCTTTGGAAATCTTTGAAAACTTGCCCAACTATTTCCTTATATCTTGGCGTTGTTATA
GGAAGCAAAACGTAATCATAGTTACTAGGCAGTTCTGGTGAATGACTAGAGACATTTTCT
AGGAAACGTGACTTTTTGCTGTGCTGTTTATGATTAAAGCCTGGTTTGACACCAACAAAT
ACGTTGCTATGCATATGCAAACTGAACCCTTTGTATATATAAAAATTATATGTATAAAAG
AAGAGGAACGTCCGCACAATTCCACACACACACACACACACACGCTTTCACACACGCAAT
TTGAAATAGCTCCTATAGGGCTTGGGAATAGGATCACAAGTCACTCGAAATATACCATTT
TTTCTATCACACATACACATTGTATAAAGCCATTTGTTTCAAAAAAATATAAAAACACTG
CGCAGCGTGCTGTTTCGGGTTCCATTTGTGATTGTTTATTTTTCTTTTGGTTTAGCTCAG
TGCAAAACGAGGGCTCGAAGAATTTTCAGATAAAACAGTACTCGAGCCCTGAGATCTGTT
TTAGGGTCTAAAAGGCGGGTTATAAAAATATGTCAGGTGATTTTTTTTTCTCGTGGTATG
AGATAAATAAAGAATGGAGCTTTTATGCATGAAAGGACAGCGGATGGCAGTAGAGCAGAC
ATCAGTAGCATTCATTACAACTCTGTCGTAAGTTCTTGGAACTGCTGGCCGCGTTGGATA
CAACTAGATTGACACGCACTTACTCTCGTCTTACAGTACT
Chromosomal Coordinates Chr II from 504854-505306
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator