Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GRS1
Systematic Name YBR121C
Description Cytoplasmic and mitochondrial glycyl-tRNA synthase that ligates glycine to the cognate anticodon bearing tRNA; transcription termination factor that may interact with the 3'-end of pre-mRNA to promote 3'-end formation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GRS1	6319597 upstream sequence, from -1000 to -1, size 1000
ATGTCAAAATGGAGTTGAGTGATGGAAGTGTAGTTATCCGGAGATCCCAATATCCAAAGG
GTGAAATTAGATTAATTCAAGACCAGAGAAATAATCCGCTGTGGAATCCTAGCAGGGATG
ACCTAGTCGTTGTGGATGCTAATTCTGGTGGTAGCTTGGACAGATTTAACAAGAGGTATA
GCTCTTTGTTTTCTGTCGATTCAACGACCCCAAATTCAAGCTCTGAAACAGTTGAACTAT
CTGAAGAAAATAAAAAGAAAACACAGATTAAAAAGGAGGAGAAGGAAGACGTTTCTGAAA
AAGCGTTCGGTATGGATGACTATCTATCTCTGTTAGACGATAGTGAACAACAGATCAAAT
CAGGTAAGTTGGCCAGTAAGAAGAGAGACAAGAAGTGAATAGTGTTTGCTCCCCTTACTT
TTCTATTCTCGAACCAATTTATATTCCTTTTGGGACATAGATCTCAATCGCATCTGTTTG
AAGACTACATAAACAGCCTTGTATATACCGCAACATATACACATACGTCTACATATGTAT
ATATTGACAACGAAGATTCTGCGAACGCTTGGTTTGGCGCTATCGCGATAGATTAAGTGC
AACAAGACACACATTTACAAACATAATATGAACCAGATATGATTCATGGATTATCGAGGC
AAATGGTCTGTGAATGAAGCTCACTTACGCTGCAATAAGCAGCAACGGCATTGTAGTGAT
CATTTTCTACGCCTCGTAATATTTCAGCGCAGTGGAAAAAAATTGAAAATTTTTACTCTT
CTCGAGTGTTGAATCACTGCTGCGATACTTATCACGTACTTTGTATACATAATTTTACTT
GCAATTAGGACTCGAAATCTGTTCAATTACTTTTGAGGATTTCTTTTATTTTAGTTTCCC
TTTTTGCATTCGTGTTGATTTTCAAGAAAAATTGTCGTTCTTCAATATCAGTAGACGATT
TTACTCTCAGATTGTTAAAAAATCGGTTAAGATTAAAAGA
Chromosomal Coordinates Chr II from 483367-481364
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator