Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TIM12
Systematic Name YBR091C
Alias MRS5
Description Essential protein of the inner mitochondrial membrane, peripherally localized; component of the TIM22 complex, which is a twin-pore translocase that mediates insertion of numerous multispanning inner membrane proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRS5	6319567 upstream sequence, from -1000 to -1, size 1000
AAACACTTTGAGTGCTGGTAATGCGTGCCCAGGATGGGATGAAGATGCTAACGATGACAT
TTTGGACAAATACGATACCACATACTTGGATGACATTGCCAAGAGATTAAACAAAGAAAA
CAAGGGTTTGAATTTGACCTCAAAGGACGCCAACACTTTGTTTGCATGGTGTGCATACGA
ATTGAACGCTAGAGGCTACAGTGATGTTTGTGATATCTTCACCGAAGATGAATTGGTACG
TTACTCATACGGCCAGGACCTGGTATCGTTTTACCAGGATGGACCAGGTTATGATATGAT
CAGATCCGTCGGTGCCAACTTGTTTAACGCTACTTTGAAGTTGTTAAAGCAAAGTGAAAC
TCAAGACTTAAAAGTCTGGTTGAGTTTTACCCACGATACCGATATCCTAAACTATTTGAC
CACCGCTGGTATAATTGACGACAAAAACAACTTAACTGCCGAATACGTTCCATTCATGGG
CAACACCTTCCATAAGTCCTGGTACGTTCCTCAAGGTGCTCGTGTCTACACCGAAAAATT
CCAATGTTCTAACGACACCTACGTCAGATACGTCATTAACGATGCTGTCGTTCCAATTGA
AACCTGTTCCACCGGCCCAGGGTTCTCTTGTGAAATCAATGATTTCTACGACTATGCTGA
AAAGAGAGTAGCTGGTACTGACTTCCTAAAGGTCTGTAACGTCAGCAGTGTCAGTAACGT
CACCGAATTGACCTTCTACTGGGACTGGAATACTACTCACTACAACGATACCCTATTAAA
ACAATAAATTGTATAAATAAATAATATTGCAAATATAAATAAATACCCATCGATTCTGAT
CTTCTTTTATGTACTAGTAGGGTAACGAGTTTGTAGATTAGCGGCAGAATGAAAAGAAAA
AAGTTAACTAAAAAGTAAGAACAGCAAAGTTGATTGTAGTCTATATTGCTGAAATAGATA
TCGGAGCTCCCGTATAATATTAAAGTGCACCAAGAAAAGG
Chromosomal Coordinates Chr II from 427484-427155
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator