Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NHP6b
Systematic Name YBR089C-A
Alias YBR090C-A
Description High-mobility group (HMG) protein that binds to and remodels nucleosomes; involved in recruiting FACT and other chromatin remodelling complexes to the chromosomes; functionally redundant with Nhp6Ap; homologous to mammalian HMGB1 and HMGB2
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NHP6B	6319565 upstream sequence, from -1000 to -1, size 1000
AAAGGATGTCGTTCTTTTTAAATAGTCTAAGGGGCAACCAGGAGGTCTCGCAAGAGAAGC
TAGACGTTGCAGGAGTGCAATTCGATGCGATGTGCTCGACTTTCAACAATATTCTCAGTA
CGTGTCTTGAGAAATGTATTCCGCATGAGGGCTTTGGTGAGCCTGATCTAACGAAAGGTG
AGCAATGCTGCATAGACAGATGTGTGGCAAAGATGCATTACAGCAATCGCCTCATTGGAG
GATTTGTACAAACACGAGGTTTCGGGCCAGAGAATCAGCTACGACATTATTCGCGATTTG
TGGCCAAAGAAATAGCTGATGATTCCAAAAAATAGCTGTAAATATGAGGACTGTCTGTGC
TGTTTGTATATAATAGTAACCTGCATATATAGCATTATAAGCTGTGTAGACAATTTTAGA
AGTACATTTATATGGTACCCGCACCTGGGTCACGTGCATTCCCCTCACCCGTTTTTTTAG
GTGGTGTCTTTTTTGTTTTTTTTTTTAGGTGGCGCGGCAACTATAAAGTACAGCAAGTGA
GGTTGAGGCAATACTGGGAGTTTACACTATGGGAGACAGCTCCTAACACCAAGCAGAAAA
ACGACTTTTTCGCAAAGTATGTAAGGCGCTGGGTGAGCCCAGCGGACGAGGATGGGCTTA
ATAAGAACGTACAGTTTAGCACAGCTAGAACAGGATACAGCTAAGGGCAACTCTGCTTTT
CGGGAGAAGTTAAAGAGGGGTAGACAATGATGGTAATCTTATAAACCGGCTACAATGAAG
GTTGTAGCAGCAAGGAAGATGATATTTTAATACGGTTCAGGTGAAATGAAATAGCCGCCC
ATAACGGCATGCTCAAGTTGTAAGTCAGGACTCTAGCTTTCTACTGTAGTATCCTCTAAA
GGACTGCTGTTCTGTGCACCCCCTTCCTTTGTTTATCATAGCGCACGACAAGAGTACTAA
CTAATTAACTTAGAACATTAACATATATAAAACTAGCGCT
Chromosomal Coordinates Chr II from 426489-426190
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator