Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PET9
Systematic Name YBL030C
Alias AAC2, ANC2, OP1
Description Major ADP/ATP carrier of the mitochondrial inner membrane, exchanges cytosolic ADP for mitochondrially synthesized ATP; also imports heme and ATP; phosphorylated; required for viability in many lab strains that carry a sal1 mutation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PET9	6319441 upstream sequence, from -1000 to -1, size 1000
ACAAATTATGTAGTGAAGATCAAAGGATATACACACAAACGAAGATGCGCATTAGCCACG
TCCATCCCTTTCCCTTTTTCCCTTTCTACTCCGTTTTTACAATAATGTACGTTATAAAAC
AAGCGGCTGAAGAACAAGTTGGGAATAAATGTCAGCAAGGAAGATTGGTGTAAAGTGAAA
TCAGATAAGCAACTTAATACACAACCTCAAAAAGAAAAAATTACCATGTCATTCATACCT
ATTGTATGTGGTATGAAGAGTTTCGACTCTTCATACGATACCGTTCCCGGACATCAAAAC
CTGTATTGCCCGAATTGTCACAATTATAGTGTCGGCCCCATAAAAAGAAAGGAATTTTTC
ACTATTTGGTTTATACCGTTGGTTCCGGTCTTCTGGGGAAAACAGTTGCACTGCCCCATA
TGCAATTGGCGACAAGATTTTAAGAATGACGAACAGCTTAATAAAGTCATTCAAGAACAA
CAAAACTTACGACAAAAGCAGCCCAACTGATAACGAAATAATTTCCTTTTCTTCCTCTTA
TATATGTATTTATATATATGTGTTCACTATAACCATACATATATTATACAGAAGTATAGA
CACGATTTTTCCATACGTAACAAATAACATCACGATGCACGAGCACTGTTTCCAATGGAG
AACAAGCGAAAGGCGGTAAATGCGCTATGCTGATTGGTGTAGAGCGCGGGCCAATGAGAA
GGCCCCACTCTCAGAGGGTGAGGTGCGATTATCGGGGACATGTCTCCGTCGATCGGGCCC
ACGTCGTCGCACAATATAAATACCATTTGAGTTTTTAATATTAATTTTTCACGACAACCC
ACTCAAAAAAGTATATATTCACTGTTAGTTATACGGAACATTGCAATACATCTACAAGTC
AAAGGAGCCCCTCTATATTATTTATATTTGTCGTTGTTCTTTTTTGTGTGCTCTTTTATA
CTTCAGAATCATACATTAACATACATATAAGCAAATAGCC
Chromosomal Coordinates Chr II from 163997-163041
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator