Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HTB2
Systematic Name YBL002W
Description Histone H2B, core histone protein required for chromatin assembly and chromosome function; nearly identical to HTB1; Rad6p-Bre1p-Lge1p mediated ubiquitination regulates transcriptional activation, meiotic DSB formation and H3 methylation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HTB2	6319471 upstream sequence, from -1000 to -1, size 1000
TACCCAATAGCTTGTTCAATTCATCATCATTTCTGATGGCCAATTGTAAATGTCTTGGAA
TAATTCTGGTTTTTTTGTTATCTCTAGCAGCATTACCAGCCAATTCTAAAATTTCAGCAG
CCAAATATTCTAAGACAGCAGTTAGATAGACTGGAGCACCAGAACCAATTCTCTGGGCGT
AGTTACCTCTTCTTAGCAATCTGTGCACTCTACCAACTGGGAATGTTAAACCAGCTTTAG
CAGATCTAGATTGAGAAGCTTTAGCAGCTGAACCAGCTTTACCACCTTTACCACCGGACA
TTATATATTAAATTTGCTCTTGTTCTGTACTTTCCTAATTCTTATGTAAAAAGACAAGAA
TTTATGATACTATTTAATAACAAAAAACTACCTAAGAAAAGCATCATGCAGTCGAAATTG
AAATCGAAAAGTAAAACTTTAACGGAACATGTTTGAAATTCTAAGAAAGCATACATCTTC
ATCCCTTATATATAGAGTTATGTTTGATATTAGTAGTCATGTTGTAATCTCTGGCCTAAG
TATACGTAACGAAAATGGTAGCACGTCGCGTTTATGGCCCCCAGGTTAATGTGTTCTCTG
AAATTCGCATCACTTTGAGAAATAATGGGAACACCTTACGCGTGAGCTGTGCCCACCGCT
TCGCCTAATAAAGCGGTGTTCTCAAAATTTCTCCCCGTTTTCAGGATCACGAGCGCCATC
TAGTTCTGGTAAAATCGCGCTTACAAGAACAAAGAAAAGAAACATCGCGTAATGCAACAG
TGAGACACTTGCCGTCATATATAAGGTTTTGGATCAGTAACCGTTATTTGAGCATAACAC
AGGTTTTTAAATATATTATTATATATCATGGTATATGTGTAAAATTTTTTTGCTGACTGG
TTTTGTTTATTTATTTAGCTTTTTAAAAATTTTACTTTCTTCTTGTTAATTTTTTCTGAT
TGCTCTATACTCAAACCAACAACAACTTACTCTACAACTA
Chromosomal Coordinates Chr II from 236492-236887
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator