Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YAR010C
Alias YARCTyA1-1
Description Retrotransposon TYA Gag gene co-transcribed with TYB Pol; in YARCTY1-1 TYB is mutant and probably non-functional
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR010C_YAR010C	YAR010C upstream sequence, from -1000 to -1, size 1000
TGTCTAATACCAATATGTCCGATCCGGCTTCGAAGCCCAATTCTTTGGTTCAACATCTCT
ATGCTCCAGTTTTTGACAGAATGGATGTGTTGATGAAACAATTGGATGAAATTATTCGTA
AATGATATTGTCCTTACAATAAAGCCTGGTCTTTTTCTCATCCAACGAACTTGCATCATA
TTCATGAATATTTATTTGTTTTAGAAACATTTCGGAAAAAATAAGGTAGTAACAGTTCAG
CATATATGATAGCTAAAACAAACAACTATATATCGTATCTACAAAGTTTATCTTACTTCT
TCTATTTTTTAACTTTGCTTCAGATTATGATAATGAAAAGGAGGAATAAAATTCTGTCAT
TATTCAGCATCCTCCAATGTGTCATAGGGATATAACTGGGGTTGAGGAGGTAGTAGTCGA
CAACTACTTAGTCGTGATACAACAGTATGGATAGGTACTTTCCACGAACATTACTGATGA
CAGTCAGCTATTCACGAATTCAATTGTGTTGGATTAACAAAAAAATTTGGACGCAACCGG
AATCGAACCGATGACCTCTTCCTTGCAAGGGAAGCGCGCTACCAACTGCGCCATGTGCCC
AACTCATTACAATACTAGACTTATGAAGGAATGGTAAGTGCTTAGAAGCTTTATGATGTA
GTAGAGATTTAAGGCCATCAATTACATTGTTGAAAATAAGAACCTGTTGGAATAGAAATC
AACTATCATCTACTAACTAGTATTTACATTACTAGTATATTATCATATACGGTGTTAGAA
GATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTG
ATAATGTAATAGGATCAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATA
TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAACTTCT
AGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA
Chromosomal Coordinates Chr I from 165866-164544
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator