Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ACS1
Systematic Name YAL054C
Alias FUN44
Description Acetyl-coA synthetase isoform which, along with Acs2p, is the nuclear source of acetyl-coA for histone acetylation; expressed during growth on nonfermentable carbon sources and under aerobic conditions
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ACS1	6319264 upstream sequence, from -1000 to -1, size 1000
AAGTGGTCTGCAAATGCTTTGCAGACGCCGGAGTAGTGTCGTTTGTGTCAGAGGAACGTG
CTGTACCGCTGCACAGTACGAAACACGTTAAAAGGCACCTTGCGAAGGTGTTTAGGAAGA
TCATGGCTATATAATCTTTTTATCACGTCAATATAATCGTAATGAAACAGAAATGAATGT
ATTATAATACACTGAAACACGGTATAGCGCAGCAAATTGTTTTAGTTTAAGGGGTATAAA
TGTTTTCCAAGGGTGGTGTTCTATATATATATGCCATTCATATACTTTTAATAATGTTCT
ATACGTATTCCCGTGAAGGCATTAATGATTATCTTTTTCTTTAAAAATGCAAGATGGCTG
AGTAGTCGCGCGAAAAAAAAAAAAAAAAGAAACAGCAAGGTTAATTTTAGAATACCAACA
GGAAAAAAGAAAAGATTATCCTCCCAGAAAAACAATCTGTTTATTACCCGACATTCTTAA
AAAAACAAAAGCAAATCACATGTGCACATACGTCCAGAATGATATCAAGATAAATGGCAC
GTGTATGTACGGCTGTGTAAATATGATAATCATCTCGGACGAACGGCGTAGCACTCTCCA
TCCCCTAAAAATGTTCACGTGTGACTGCTCCATTTCGCCGGATGTCGAGATGACCCCCCC
CCCTCAAAAGGCACTCACCTGTTGACATGCCGTGGCAAATGATTGGGGTCATCCTTTTTT
TCTGTTATCTCTAAGATCCAAAGAAAAGTAAAAAAAAAAGGTTGGGGTACGAATTGCCGC
CGAGCCTCCGATGCCATTATTCAATGGGTATTGCAGTTGGGGTACAGTTCCTCGGTGGCA
AATAGTTCTCCCTTCATTTTGTATATAAACTGGGCGGCTATTCTAAGCATATTTCTCCCT
TAGGTTATCTGGTAGTACGTTATATCTTGTTCTTATATTTTCTATCTATAAGCAAAACCA
AACATATCAAAACTACTAGAAAGACATTGCCCACTGTGCT
Chromosomal Coordinates Chr I from 45022-42881
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator