Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CDC19
Systematic Name YAL038W
Alias PYK1
Description Pyruvate kinase, functions as a homotetramer in glycolysis to convert phosphoenolpyruvate to pyruvate, the input for aerobic (TCA cycle) or anaerobic (glucose fermentation) respiration
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC19	6319279 upstream sequence, from -1000 to -1, size 1000
AATGCTACTATTTTGGAGATTAATCTCAGTACAAAACAATATTAAAAAGAGGTGAATTAT
TTTTCCCCCCTTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAG
GAAAAAAAAAAAAAAAAAAAAAATAGCCGCCATGACCCCGGATCGTCGGTTGTGATACGG
TCAGGGTAGCGCCCTGGTCAAACTTCAGAACTAAAAAAATAATAAGGAAGAAAAAAATAG
CTAATTTTTCCGGCAGAAAGATTTTCGCTACCCGAAAGTTTTTCCGGCAAGCTAAATGGA
AAAAGGAAAGATTATTGAAAGAGAAAGAAAGAAAAAAAAAAAATGTACACCCAGACATCG
GGCTTCCACAATTTCGGCTCTATTGTTTTCCATCTCTCGCAACGGCGGGATTCCTCTATG
GCGTGTGATGTCTGTATCTGTTACTTAATCCAGAAACTGGCACTTGACCCAACTCTGCCA
CGTGGGTCGTTTTGCCATCGACAGATTGGGAGATTTTCATAGTAGAATTCAGCATGATAG
CTACGTAAATGTGTTCCGCACCGTCACAAAGTGTTTTCTACTGTTCTTTCTTCTTTCGTT
CATTCAGTTGAGTTGAGTGAGTGCTTTGTTCAATGGATCTTAGCTAAAATGCATATTTTT
TCTCTTGGTAAATGAATGCTTGTGATGTCTTCCAAGTGATTTCCTTTCCTTCCCATATGA
TGCTAGGTACCTTTAGTGTCTTCCTAAAAAAAAAAAAAGGCTCGCCATCAAAACGATATT
CGTTGGCTTTTTTTTCTGAATTATAAATACTCTTTGGTAACTTTTCATTTCCAAGAACCT
CTTTTTTCCAGTTATATCATGGTCCCCTTTCAAAGTTATTCTCTACTCTTTTTCATATTC
ATTCTTTTTCATCCTTTGGTTTTTTATTCTTAACTTGTTTATTATTCTCTCTTGTTTCTA
TTTACAAGACACCAATCAAAACAAATAAAACATCATCACA
Chromosomal Coordinates Chr I from 71786-73288
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator