Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CYS3
Systematic Name YAL012W
Alias CYI1, FUN35, STR1
Description Cystathionine gamma-lyase, catalyzes one of the two reactions involved in the transsulfuration pathway that yields cysteine from homocysteine with the intermediary formation of cystathionine
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CYS3	6319307 upstream sequence, from -1000 to -1, size 1000
ACAGAGGATGACTGCGCTGAAGGAAATCACCGACATCGAGTACAAGTTCGCGCAATTGCG
CCAAAAACTATATGACAATCAATTGGTGCGGTTGCAAACGGAGCTGCAGATGTGTCTGGA
AGGGTCACACCCGGAATTGCAGGTCTACTACTCGAAGATTGCCGCGATCCGTGACTACAA
GCTACACCGAGCGTACCAGCGACAGAAGTACGAGCTTTCATGCATCAACACAGAAACAAT
CGCTACCAGGACATTCATTCACCAGGACTTCCACAAGAAGGTCACCGACCTGCGAGCCAG
GCTGCTGAACAGAACCACGCAGACCTGGTACGATATCAACAAGGAGCGCCGCGATATGGA
TATAGTCATCCCAGATGTCAATTACCACGTCCCCATCAAACTTGATAACAAGACGCTGAG
CTGTATCACGGGCTACGCAGCGCACGACAGCTGTGCTATCCCGGCGAGCCCGTGGCAGAG
GACCTCGCTTGCGAAAGCATCGAGTACCGCTACAGAGCCAACCCGGTGGACAAACTCGAA
GTCATTGTGGACCGAATGAGGCTCAATAACGAGATTAGCGACCTCGAAGGCCTGCGCAAA
TATTTCCACTCCTTCCCGGGTGCTCCTGAGTTGAACCCGCTTAGAGACTCCGAAATCAAC
GACGACTTCCACCAGTGGGCCCAGTGTGACCGCCACACTGGACCCCATACCACTTCTTTT
TGTTATTCTTAAATATGTTGTAACGCTATGTAATTCCACCCTTCATTACTAATAATTAGC
CATTCACGTGATCTCAGCCAGTTGTGGCGCCACACTTTTTTTTCCATAAAAATCCTCGAG
GAAAAGAAAAGAAAAAAATATTTCAGTTATTTAAAGCATAAGATGCCAGGTAGATGGAAC
TTGTGCCGTGCCAGATTGAATTTTGAAAGTACAATTGAGGCCTATACACATAGACATTTG
CACCTTATACATATACACACAAGACAAAACCAAAAAAAAT
Chromosomal Coordinates Chr I from 130799-131983
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator