Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MLC2
Systematic Name YPR188C
Description Regulatory light chain for the type II myosin, Myo1p; binds to an IQ motif of Myo1p, localization to the bud neck depends on Myo1p; involved in the disassembly of the Myo1p ring
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPR188C	6325446 upstream sequence, from -1000 to -1, size 1000
CTCGACCATTTCCTTAACTTTCGTGAAAAAATCTTTTTTTACATCCAGCGGCATTGATTT
TAGCACTTTGATTCTATATTCTAACCACTGGTTCTCAATTTCACTTCTCTTTTGATCGTC
AGCGAGAATATTTACCAACTGGTTGTATAACTGATCAATTTCTGAATTTTTAATTATTTC
CCAGGAGAATGAATTTAGTTTAATTTGATAATCAGGATCACTAGCTTTTAGTTTTAACCT
GTTCTGACTAAGGGTCTTACCTATTTCCGTTGTTTCAATATTAGACAGTATCTTTATAAG
ATTTAATAAAGCGTCCTGGGGTGTAGATAGATGACGACCAATAGTTTCCGCCATTAGCGA
CCCAGGTTTCAAATGCTGATAAAAGGCTTTTTGACAATCTGGATGCGTTTTCTTTAGTAA
TTTTATGTCATTTATTAGTTCTACTTGAGACTGTTCCTGCTTTAAAAGTGCGTCTGCATA
TTGGCCACACAGGTCAAAATATTCATCATACGAAAGTATGTCTGGGACAACCTCAGTGGT
TCTAAATAAGAGAAAAAGTCCTTTCCACGCTAAAAGGTTATCAGGAACTAATTTGGCAGC
GGACACGTAATGATTAGTAGCTCTCTCCAGGTTCCGATTTGAACTGACATTATTACTAGC
TGGAAGACTCGAAAGTGCTTTCCCTAGAAAAATATGTGCGAAATAATTATCGGGATCTAG
TTTAAGAACCTTTTCCGATATTTCGATGGTCTCTTCATAGTCACGATTTGTCAATTCTTG
TTTGGCTTCCTTCAATAGCTGTTTAATATCCGACATATTTCCTCTGCTCTTCGTGTTTCT
TTTCTGTGTTCTTAGTGTCTTTCTTGACAAGAAAGTTTTATTAGTTAGTTGTTTTCCAAC
TTTATTTTTTTTTTTACATTTCTCGTATTTCTAAACTATACAATGCACAGCTAAGAAAAG
AGTAATTTCGAATCGTTTATTGAGCAAACTTGAAGTAGAT
Chromosomal Coordinates Chr XVI from 912479-911988
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator