Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GDB1
Systematic Name YPR184W
Description Glycogen debranching enzyme containing glucanotranferase and alpha-1,6-amyloglucosidase activities, required for glycogen degradation; phosphorylated in mitochondria; activity is inhibited by Igd1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GDB1	6325442 upstream sequence, from -1000 to -1, size 1000
ACCTACAACACCCTCCAGAGACCGTGCCCAAGTTGTTCGAGTCTTTGCACGATCACGCCT
TTACTCTGGGCACCAGATATGCCCCAGGTGTCGGCATTGACAAGGACTGGCCTATGTACA
GACGCGTCATTTCCTCCACTGCTAGAATGATGGCCAGACCTTTGACCATCGCCTCCGACC
CCATGAGCGGGTTCTTCGGTCTACAAAAGAAGTACCTCGAAAACTGCAACCCTAGGGACA
TCAACTCGCAAGGTTTCAAGATTGCCCTCGAGCTTCTCGCCAAGCTTCCTCTTCCAAGAG
ACCCTAGAGTGGCGATCGGCGAAGTGCCATTCACTTTCGGCGTGAGAACGGAAGGTGAAT
CCAAACTGTCAGGTAAAGTCATTATCCAATACTTGCAACAACTTAAGGAGCTCTACGTCT
TCAAGTTTGGCGCCAATAACCTTATCCTTTTCATTACTTTCTGGTCCATTCTGTTCTTCT
ACGTTTGCTACCAGCTATACCATTTGGTCTTTTAAAGGAAGTGAATGGTAACGAAAAAAA
AAAATCTTTCTTTATATGTCTCTTTAAGTACTCCCTTTCAGTTATATGCCTTTTATTGTC
TGTCCCTATTCTAATCCTCTACTCGGGCCATCATTGTTAACGTAATATTTGCCCTAGGGT
AAAAACATTAGGTTGATTAGGCCATAACTCATTCTGCCCCACCCCCACACATAGGGTTCA
GGAACTTGGTTTTCAACCCTACTGCATTGTTTCCCACGCGGCGCTACCAAAATATATCCA
ATTTTCTTTTTTGTCACAACAGCAGCAACCCCTTGAAATGGCCAATTCTTCTCGAGACTT
TGCTCCCTTAATCTTTTCTTCCCCCCCGGTTTCTTGATGATTATATATACTAACCTCGTA
TATTACACACTGTACTTGAAGTCACTCATATCCGAATACTACTTCTCTTAACTTCCAGTC
AACCCGACACCCACAATCGTCCTTAGTATATAACTGCTTT
Chromosomal Coordinates Chr XVI from 902044-906654
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator