Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MET16
Systematic Name YPR167C
Description 3'-phosphoadenylsulfate reductase, reduces 3'-phosphoadenylyl sulfate to adenosine-3',5'-bisphosphate and free sulfite using reduced thioredoxin as cosubstrate, involved in sulfate assimilation and methionine metabolism
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET16	6325425 upstream sequence, from -1000 to -1, size 1000
TGATGCCATGATTTCTATGTTAAAATTTTTCTAACCATGAAATTTTTTTTTTCTAGCGAG
AAAAAAAATCAGAAAAATTACTATTAGTGAGTATTGGAGACATTGTCAATGGGAGATGTT
CTCTTTATAATATCTTCAACAGGTTCTTTCAACTCTGGAAATTCATCCACAATCTTGTCA
GCAAGTGAATCTCTTAATTGCTTCAATCCATGCATCTTGCCTCTTTGATATTGGTTGGAT
CTTCTTATGGCTTCCACGAACTCTCTTGTGTAAATATCTGGATTTCTACCGTCCTCAATG
TATTGAACAACTTCCAAGGGAATGTCCACCTTAGACAAGCTGGATTGAGGATCGTTGCTT
CTCACGTTCAGCTTGTACAAGCGATCCACATTTCTTTGCAAGTTGGTGATCATTCCCTTG
GTGGCTTCTGGAGTACCAGGAAAATCATATATCGAGACACCTAATTCAACGAAGGACTCA
ATAATCGAAGCCACTTGGTCTTGAGTAGTGGCCAGTTCTTGCTGCAATTGTTCATTGTTA
GTGCTGTTTCCATTCATCTTATCGGTTTATTTTTCTATATATTTGCCTCTTTCTCAAACA
GGAGTTAGTAGTTAAAAGTACGAAGTTCTTGTTCTTTAATGCGCGCTGACAAAAGAATTG
GATAAAAGAGAATGGTGGGGGGACAAGAAGGAAATTTGTCCTAGTTTAACATGAATGGCA
TCTTGTTACCGGGTGGACATCACCTATTGATTCTAAATATCTTTACGGTTTATCATACTG
TTCTTTATTCCGTCGTTATTCTTTTTATTTTTATCATCATTTCACGTGGCTAGTAAAAGA
AAAGCCACAACATGACTCAGCAAATCTCGACAAAGTAAAAGCTCATAGAGATAGTATTAT
ATTGATATAAAAAAAGTATACTGTACTGTTTGTAACCTTTTCAATGCTTTAAGATCAAAA
CTAAGGCCAGCAAAGGTATCAACCCATAGCAACTCATAAA
Chromosomal Coordinates Chr XVI from 877632-876847
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator