Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ORC4
Systematic Name YPR162C
Description Subunit of the origin recognition complex, which directs DNA replication by binding to replication origins and is also involved in transcriptional silencing
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ORC4	6325420 upstream sequence, from -1000 to -1, size 1000
AGAGGTTCTAACTTCAGAGGTCCAAGAAGAGAAAGAGAAGAAGTTGATATTGACTGGACT
GCTGCAAGAGGTTCCAATTTCCAAGGCTCTTCCAGACCACCAAGAAGAGAAAGAGAAGAA
GTTGATATCGACTGGAGCGCTGCAAGAGGCTCCAATTTCCAAGGCTCTTCCAGACCACCA
AGAAGAGAAAGAGAAGAGCCAGATATTGACTGGAGTGCAGCTAGAGGCTCTAACTTTCAA
AGCTCCTCGAGGCCACCAAGAAGAGAAAGAGAAGAGCCAGATATTGACTGGAGTGCAGCC
AGAGGTTCCAACTTCCAAAGCTCCTCAAGACCACCAAGAAGAGAAAGAGAAAAGGAAGAA
CCAGCTTTGGATTGGGGTGCTGCCAGAGGTGCTCAGTTTGGTAAGCCTCAACAAACCAAA
AATACCTACAAGGATAGGTCTCTAACTAACAAAAAGACTACTGATGAGCAACCAAAAATC
CAGAAGTCTGTTTATGATGTTTTACGTACTGAAGATGATGATGAAGATGAAGAGGCTGAA
AAGCAAAATGGAGACGCAAAAGAAAACAAAGTTGATGCGGCAGTTGAAAAGCTACAGGAT
AAAACTGCTCAATTGACTGTTGAAGATGGTGACAATTGGGAAGTTGTTGGTAAGAAATAG
AGTGTTGTATGATGATAAAATGTACATTTGTATTTACTGTTTGCTTTTTTTCTTTCTTGT
TTTTCTACTCTCCTTTCTACCAGGTATTCTAACTCTATTATATAATTAAAAAAAAAATAA
CCATATATTTTGTATTAAGTTTCATACATGTGTTCAAGTGTATTTTTGGATTTATCATTT
TTCTATGTGAGGTAAGTTTTTGAATGTCCCATTTTCCTTTCGTTTTTGGAAAGTTCTAAG
AAAAAGCATTAACAATTAAAAAAAAAAAAAAAATCTAAATAATACTGATAGAAATATCAA
ATATAAACTACTAATATCGGTAATATTCAAAAGAAGAAGC
Chromosomal Coordinates Chr XVI from 868304-866715
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator