Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name KRE6
Systematic Name YPR159W
Alias CWH48
Description Type II integral membrane protein required for beta-1,6 glucan biosynthesis; putative beta-glucan synthase; localizes to the ER, plasma membrane, sites of polarized growth and secretory vesicles; functionally redundant with Skn1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KRE6	6325417 upstream sequence, from -1000 to -1, size 1000
CGTCATCCTGAACGTTCATAAAACACATATGAAACAACCTTATAACAAAACGAACAACAT
GAGACAAAACCCGTCCTTCCCTAGCTGAACTACCCAAAAGTATAAATGCCTGAACAATTA
GTTTAGATCCGAGATTCCGCGCTTCCACCACTTAGTATGATTCATATTTTATATAATATA
TAAGATAAGTAACATTCCGTGAATTAATCTGATAAACTGTTTTGACAACTGGTTACTTCC
CTAAGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTACTCGAGCCCGTAATACA
ACAATTTACAACAAGATTCGGGCGTGTGGCGTAGTCGGTAGCGCGCTCCCTTAGCATGGG
AGAGGTCTCCGGTTCGATTCCGGACTCGTCCATTTTAATTTTTGATTATGGAATACAAAA
TGTATATTTCGTATAAAATTATCTTTATTGTTTTTGTGGCTTAGTGATTTTCATTCCCCT
CTTTTCTTTTTCCTCTCAGCCTGCAAGTGTGACGCGATCTGAAAGGCGTTTTACCCGCAA
AACGCCAAAGAATCATCCTGAAGCGGTAAATTCTAGACTTCAGATCACATACGCTCTATT
TGGACAGTTTTTTTTTTTTTTTCATATTCCTGATCAGATGAAAGTTAACGCTATTTTTGG
TGAAAACACAGAATAAAACAGCTTCTGATAAAATTTAACTAGGAACGTCGAAAACAACAA
CCGTTAAAATATTTTTAGCTTACAGAAGCACTTAAGAATCACTAACGTTTTCTTCTTTTT
TTATTTTCAGTCCAAAGCTTTCGTATTGCTGCAAGTGCTCGAGAAAGCTGCATATTGTTA
TTGTATTCGTCCTCTCGTACTAGTGTTCATTACTTTATCGTCTATAAATATATTGTTGTT
AGAATTTTTCTACTAAGGCAAGTTAGTAGTTGCACAACATTTCTCTCGTTAAATCATCTA
AAGTTTACAGAATAGGTATACCACTCACTCCTTTACTCTA
Chromosomal Coordinates Chr XVI from 857583-859745
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator