Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YPR158C-D
Description Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid-like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPR158C-D_YPR158C-D	YPR158C-D upstream sequence, from -1000 to -1, size 1000
TATTCTGTGTTTTCACCAAAAATAGCGTTAACTTTCATCTGATCAGGAATATGAAAAAAA
AAAAAAAACTGTCCAAATAGAGCGTATGTGATCTGAAGTCTAGAATTTACCGCTTCAGGA
TGATTCTTTGGCGTTTTGCGGGTAAAACGCCTTTCAGATCGCGTCACACTTGCAGGCTGA
GAGGAAAAAGAAAAGAGGGGAATGAAAATCACTAAGCCACAAAAACAATAAAGATAATTT
TATACGAAATATACATTTTGTATTCCATAATCAAAAATTAAAATGGACGAGTCCGGAATC
GAACCGGAGACCTCTCCCATGCTAAGGGAGCGCGCTACCGACTACGCCACACGCCCGAAT
CTTGTTGTAAATTGTTGTATTACGGGCTCGAGTAATACCGGAGTGTCTTGACAATCCTAA
TATAAACAGTCTTAGGGAAGTAACCAGTTGTCAAAACAGTTTATCAGATTAATTCACGGA
ATGTTACTTATCTTATATATTATATAAAATATGAATCATACTAAGTGGTGGAAGCGCGGA
ATCTCGGATCTAAACTAATTGTTCAGGCATTTATACTTTTGGGTAGTTCAGCTAGGGAAG
GACGGGTTTTGTCTCATGTTGTTCGTTTTGTTATAAGGTTGTTTCATATGTGTTTTATGA
ACGTTCAGGATGACGTATTGTCATACTGACATATCTCATTTTGTGTTGGAATAAAAATCC
ACTATCGTCTATCAACTAATAGTTATATTATCAATATATTATCATATACGGTGTTAAGAT
GATGACATAAGTTATGAGAAGCTGTCATCGATGTTAGAGGAAGCTGAAACGCAAGGATTG
ATAATGTAATAGGATCAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATA
TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAACTTCT
AGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA
Chromosomal Coordinates Chr XVI from 854951-850989,856257-854953
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator