Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TOM5
Systematic Name YPR133W-A
Alias MOM8A
Description Component of the TOM (translocase of outer membrane) complex responsible for recognition and initial import of all mitochondrially directed proteins; involved in transfer of precursors from the Tom70p and Tom20p receptors to the Tom40p pore
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TOM5	6325391 upstream sequence, from -1000 to -1, size 1000
AAGTAAGTTATTATCCAAAATGGTGTCTGCCAAGTTTGCCTTTGACAGTACGCTTACCAC
CTTCGGCAACAATTTGACCTTCTGCATGGCAATCAGCGAAGTATCTCCAGTTTCTATTCT
CTTATTTAAAGTATCGATGTCCAACTGTGCTGCAATATTCATTTCGTCTTTAAGCCTTAG
AATTTTTTCATCCAAGTACTGTTCTAAATCGTCTTCATCCCTCCTCGTTCTTCTAACCTT
TGGTTTTTTCAATATACGGTCCAGTTTTTCTTCCAATTCCTGTCTACTACTTGGAGTAGC
ACTTGAATCTCTATCTTTACTAGCCCTATTTTCCACCGTTGGTTGAAGACTCTGATCATT
ATGCTCCTCCTTTTCTAGGTCGTCATCTGAGAAATCTGTGCTAATGTGCTTACGTTTCCT
TTCTGCAGCTTCTACGTTACTATTTTCGTCTATTGCGGCTTCCTCGTTCTTTTCTCCGTT
ATCTGGGTCTTTAGTATCATTGGAGGTACCTTTTGAAGTTTCTTGGGGTTCCATACTTTG
ATTTTGTTTTGTATTTTCATTCTCAGCGTTTATAGTTGACTTTTGGGAGGAAGCTGTCCC
ATCTTCTGGTGTCGCTTCCACCACTTTGGGTTGTTCTTGATCGGCTGTACTCATTGCTAA
TTGATATGTTTTTGCCTTTTATTACTAAAAGTTCCTCTATATATACTTCAGAGGACAATA
AACTCCCTTGATATGGCCTGCATATACTTTACAAGTGCTATCAAACAAAGATGCTGGGCA
ATGAAGCTGACAGTTAACTCTTCCAAAACTTCCCTTCAAAGAAATTGTGAGAGAAAAAAA
CCTTCTTGTTACCCTTCTTTGGAAGAATACCGCACATCATAAAATCAAGAAATGAATTCG
AAAGTTTACTCTTTCTTTCTAGAGGCGTTACACCAATATTAGCGAATTGCAGTTTCCCAC
AAAAGGCGTCCATTGGCATCAAATAACTAGATAGTATAAA
Chromosomal Coordinates Chr XVI from 797557-797709
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator