Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPC40
Systematic Name YPR110C
Alias RPC5
Description RNA polymerase subunit AC40, common to RNA polymerase I and III
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPC40	6325367 upstream sequence, from -1000 to -1, size 1000
TGTCCAACTTGTGTCAGTATCTGAAAATCCTTGTGCTTAGGTTTCAACCTCCTTTTTCTC
AGTACTTCGTGTTCTCTTTGCAAATACAAAGCCCATTCTTCATTTAAAACCTTATTAGAA
ACGTTTTTGACACTTCTTTGCTGTTCAAGATATCTTAGCACCTGCTTCGTACGTTGTCTT
CTGCTAATAACATAATCAAACATGTCACAGTAATAGTCGAGAAAGTAAAGTTGGCATACA
TTAACAACTCTCTGGGTTTTACTTTGGGAAGCACGCTCGTGAAAATCCTTGGGTAGCTTC
TTCGGTGAGTGATTCAATGAAATGCGATTTTTGAAGGTATCTTGATCATCTGAATCACAC
GGCTTATATGATCTTGGAAGTCCGGGAGTTAATCTTCCATTTTCGCTCTTTCTAGCAGGC
CTATATTGCGCCTGTGGAGAAGTAGGTTTAGGAATATTCAAATCATAGAACCCTAAATGA
CTCATATTACCAGCCAAATCATCTACCTCTCGATCACTTCGTGAAAACATGACTACCGAA
TTATTGTTGAATACGATATTCTGGGTTGCTAATCACTATTGGAGTTACAAGTTTGTTGCG
ACAATACAGTTCATCATGATCTGTGATCTAGCCGACTACAGGTCCATTGATTTGTGTTTA
CTCTCAAAATCTTGTATGAGGTGTATGGGTTAATTATCCATTCAAAGACAAAAATTTATG
ATCTTGGTGTTTGTATATAAAAATTAGTCAGAAGACATGCTTATTCTTGATTTTATATTA
ATTAGAAAGAGATGTTGCATTATCCCATACTTGTCGTTTGTCTTCTGCTACAATACATTG
TGCTTTATGTTGCAAATATTTATTAATTCCGTTTATAGTGACTTGGATTCACAAAAATTT
TGTGAAAAAATTATTGCGATGAGTTGAAAGAAAAAATTTCACTCATATTATGTAGAAGAG
CAGGTATCAAGTGCATGAAAGTAAGTAGGTGAAAGAAGAT
Chromosomal Coordinates Chr XVI from 746835-745828
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator