Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FHL1
Systematic Name YPR104C
Alias SPP42
Description Regulator of ribosomal protein transcription; has forkhead associated domain that binds phosphorylated proteins; also has forkhead DNA-binding domain but does not bind DNA in vitro; suppresses RNA pol III and splicing factor prp4 mutants
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FHL1	6325361 upstream sequence, from -1000 to -1, size 1000
TCGAACCAAAAGAATTACATCACAAGCATAGAAGATTTCGAAGATTTGTCGCAAATTAAC
AGTTTCAATAGCAAATGGAACCAATTGATTATCCCTTACAAAAATATTCTTCACAACGAA
GCATATGCAGAGTTGCTATCTGTCATAGTCGACTACATCGTAACAACATTGGAGCAAAGA
ATATGGACTCTAGAATTCAATGAACTTGGTGTTACGAAATTAGATAGAGAACTGAGCCTT
TTCATCGGCAATATGTGTGGCTTGAACTATAATCTCAGAGAGAAGTTCTTGAAATTGACA
CAAATCGTGTTGCTTCTCGGTTTAGATGATGACAATTTTGATTTGACTACAGGTGATATC
AAGGATGACTTCAATGGTACTTTCGATTGGGTGATAAACTCTCAGGAAAGAATTAAAGCT
AGAAATATGAAGATTGATAGAACACAGTAAATATAACATAAGCTTTACGAGCTGAATACT
AAGTAGTTTCATATAAACGCAAACATAATCTTGGCTGTTGTACCTTTTCTGCATACTCTT
GACTGTTAATACATTTCTTATTTTTCTTATGAAAGAGCACAACATGATAGCGCCATACTA
TCATTCTGAACGTTGCGATTAACTGGAAATTACGAAGACTAAGACAAGAAAAATTAAAAG
CGTTAATAAAAAATAAACAAAGGAACCTTTGAAATATATTCCGTCACCAAGCTAAGAAAG
GAGTAGCTCTTTCTCTAAGGCCAACTTTGTCATCCTTTGAGTTAGTTTAAAGTCTATTAA
TATTTGCTATTATCTTCTGGGCTGGATAAATAGGACTTTTCTATTGGCACATTTTTTTCT
CTTGTAGAAGGTCATCACGAATATTAATTTTGTATTTGAAAGCATTTTATTTTCTCCTTT
TTTTATTACCATAATATACCTGGTACTGGTTTTTACCTGATTTAACGTCTAGCCGCTCAA
AACAAAAACCCACTCATATCTATACAAATATAAGAATAAG
Chromosomal Coordinates Chr XVI from 736433-733623
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator