Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GLN1
Systematic Name YPR035W
Description Glutamine synthetase (GS), synthesizes glutamine from glutamate and ammonia; with Glt1p, forms the secondary pathway for glutamate biosynthesis from ammonia; expression regulated by nitrogen source and by amino acid limitation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLN1	6325292 upstream sequence, from -1000 to -1, size 1000
AAACAGCCATTTTTCAATATGCGCTACCCGGCGGCGGAATATCGTCCCAGCTACATGATA
GCCGCTTTTTTGTCTCTCTTTGTCCCACCTGTTCAAAGACATTTGGTAATCAGTTTGTCA
GGACAATAGTAAACAAAAGTGCGCAAGTACACATGCGCTGCACGTGCGGCCGGAACAATG
GCGCTTTTGGCTCGTCCGGATGATGCGAAAGGGAAAATAAAATCTCGCAATCGGAAAAAC
ACTCGCGAGAACCAAAACAAGGATCCCCTAAACCCAGTACCCGCATACGGTTCTCCCGGG
GAAAAGGGGGCGGAGGCCGGACGATGAGTGTTACCCGGATAGGACTACGGATCGCTTCGC
ACGTTTGTTTACAATTGATGACTGCGCTCCCCTAATAGATAAGATAAGCTCGCGAAGGCA
GAAAAAAAAAAGTCTTCTACAGCAGTTGGTCCGCACAGACGATGCCAGACGGTGTTTTAT
CGAAAATTTTTTTCGCATCATAGTGCCATTTGTGGTCATTATTATTCCCCAAATATGCGA
AAATAGTACACTATTTTTGGCAGGAGAGTAGGCTGATATGCCGCATTGATGTCCTGTGTA
GCGAAACACAAACAAAAAAAGAAAAAGTAGGATGAAAAAAAGAAAAGTAATATGAAAAAA
GAGTGAAAAATTAATTCATTTGTTAGTGTAAGCGGTCAGGTGTAAGTAGTAGGCTTGATA
ATGAATTAAAGATGACTCCGACGCATATTGTTTGCCATGTTTTTATTTTAGTTTGTAGAT
TTCTTTTTTTGTAATATATAAGGGAGTGATTCTATATATCGAATTCTCAGGCTTGGTTGG
TTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATA
GAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCG
AAACAAAAATTAAACATAATATAATATAATATAATCAAAA
Chromosomal Coordinates Chr XVI from 642208-643320
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator