Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HAA1
Systematic Name YPR008W
Description Transcriptional activator involved in the transcription of TPO2, YRO2, and other genes putatively encoding membrane stress proteins; involved in adaptation to weak acid stress
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HAA1	6325265 upstream sequence, from -1000 to -1, size 1000
ATCATCCTACTAAATTATCAATCCTTGCAATTAGCTTCTATTACACCTGATGACTGTTTT
TCAATCTTTATGTGATCTTTTTACACCCAATGTGATAAAGTACTAGTAACATGAATACTA
CTAAACAGATGATACTTTAGAGTTTTCATTCCAACACTCAATTGTAAAAATAAGACAATA
TTATGATTTTTTGGCTGTATAACCACATCTATTTAGTAGCAGGGTGACATGTTACTCCCA
CACAATACTTCGCGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCC
GGTTCGATTCCGGGCTTGCGCAATTTTTCCCCCTCGCCCTGAAGGGCGTAACGTTAACGC
TTCCGGTAATTTGCGAATAATTTTTCTTCCCATTTCCCCTTTCTTTTCCCTTTAACATGT
GGAGCATAGCAGGCTCTTTACTTTTTTACGCATTCAGACAGTCGGGAGGTCAATTGGTGG
TGCCGGTTGTGGGAAAGAGGTAATTTTATTTCCTTTATTGGACATGATTTCAATAGTCAC
ATTGGGGCAGGAAAAAGAAAAGGGAGAAAAAAATTCAGTAAAGAAAAAAAATAAGAAAAA
GAGAAAAGAAACAAGAGAGGGCTACAGATTTCTAAATATCCTTTTGCTGCACATTTTTTA
TTTACCTGCTAATTGGTCTTAGTAATACAGAGTCGTGCATTTCCACTTTATAAGAAAAAA
AAAAGGGATAACAGCACCAGCACTTGATTGAAAACTAGAAAGTTCACGTTTTATAAGTCC
TTTCCGTTCTCTTTATCAGTTATAATAAAAGAGCCAAGACAAAACGTGGCAGGGAAGCTT
TTCCAAGGAAAAGAGGGTTGTAATATTAAACAAAAACCGTAATCAAGCAAAATAAGACCC
CGTGGTTTTTTATCATAGGAAAAGAGTTCTCTGTTGTCACTCTACCATATTTGACAAGAA
AAAGGAAACAAAAGTATAGAAAAAAAAAACCTAAAAAATA
Chromosomal Coordinates Chr XVI from 573018-575102
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator