Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SRP68
Systematic Name YPL243W
Description Core component of the signal recognition particle (SRP) ribonucleoprotein (RNP) complex that functions in targeting nascent secretory proteins to the endoplasmic reticulum (ER) membrane
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRP68	6325013 upstream sequence, from -1000 to -1, size 1000
ATTTGTTATCATTTCCGCTCTCATTAAAGGATCTCTTCAACTTTTTACCATCGTTGCCAC
CTATAGTGAAAATAGTGACACCGAGACTTACCAAGAGAGCTACAACTTTTTTTTGGCTTG
CTATGGGCGTCCTATACAAAAGCAAATGCACCAACAACACGGGGATCATCTTGCATGACT
TTGCTAACATGTAAGTGAGATAATCCACGTGCTTTAAAGAAGTTGTAGCCAGCGGGCCTG
AACTACTCTGTGTAAATGATATCAACATCAATTGTTTCCAATGATCTTTAATCATTTTTC
TGGGCGGATATTCCACCTTCTTCCAGTTTAAGTACAGGTAGCCCATCATCATTGCCACAG
AAGCTTGTATGAGGGATATTACATTAGGGAATTGAAACTTTCCCATGGAGTTTGGCCAGG
TTCTTGTAGCCAAAGGCTCCTGTACTAATGCCCACGTCAAAAAAGTAGCATATATACCAA
TCGCACAGATCACCAAACTGGATGTACTTCCCGCCATACAAATATACGAATACTGCCTTG
TTTACTTCTTCTTGTTACGTTGTAATTCTGGTTCTAATTACATTGCTGTCATTTTTTCAT
GTTCGATGGGATCTACAAAACAACCTTTAGAAGCGATCTCAGGGAAGCTTTGGAAGAGAA
ACAGCTGATGATTCTGGCATTCCACAAACTACAACAACGAACCAAACGACATATTCCATT
GCAGTGATTTGATTGGGAGTAAGCTTTTATAAACGAGCAGACCAATATGATTTACGTAGT
ATTTCGTTGTCTTTACCACATCGTTGTTCGTGATAAGTTCTGAAAATTTTTTTTGGAGTA
TATTTGCTAGAGTTAATCCAACAATATTAGCATAAACGAGCAGCTGGAGACTAGGTTATT
TGAATTATTTGAGCATCAAAGTGATCAATTGTATTATATTACAGTGTAATTTTCTTTTTT
TCCATATTGAATCAAAAACTAGCCACGCTTGAAACTAAAG
Chromosomal Coordinates Chr XVI from 88517-90316
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator