Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CIN2
Systematic Name YPL241C
Description GTPase-activating protein (GAP) for Cin4p; tubulin folding factor C involved in beta-tubulin (Tub2p) folding; mutants display increased chromosome loss and benomyl sensitivity; deletion complemented by human GAP, retinitis pigmentosa 2
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CIN2	6325015 upstream sequence, from -1000 to -1, size 1000
CTTAACTGATTACGTTACCAGAATGCCAGAACACCAAAAGAACATCTACTACATCACTGG
TGAATCTCTAAAGGCTGTCGAAAAGTCTCCATTTTTGGATGCCTTGAAGGCTAAAAACTT
CGAGGTTTTGTTCTTGACCGACCCAATTGATGAATACGCCTTCACTCAATTGAAGGAATT
CGAAGGTAAAACTTTGGTTGACATTACTAAAGATTTCGAATTGGAAGAAACTGACGAAGA
AAAAGCTGAAAGAGAGAAGGAGATCAAAGAATATGAACCATTGACCAAGGCCTTGAAAGA
AATTTTGGGTGACCAAGTGGAGAAAGTTGTTGTTTCTTACAAATTGTTGGATGCCCCAGC
TGCTATCAGAACTGGTCAATTTGGTTGGTCTGCTAACATGGAAAGAATCATGAAGGCTCA
AGCCTTGAGAGACTCTTCCATGTCCTCCTACATGTCTTCCAAGAAGACTTTCGAAATTTC
TCCAAAATCTCCAATTATCAAGGAATTGAAAAAGAGAGTTGACGAAGGTGGTGCTCAAGA
CAAGACTGTCAAGGACTTGACTAAGTTATTATATGAAACTGCTTTGTTGACTTCCGGCTT
CAGTTTGGACGAACCAACTTCCTTTGCATCAAGAATTAACAGATTGATCTCTTTGGGTTT
GAACATTGATGAGGATGAAGAAACAGAGACTGCTCCAGAAGCATCCACCGCAGCTCCGGT
TGAAGAGGTTCCAGCTGACACCGAAATGGAAGAGGTAGATTAGGTAGAACATCATGGCCT
TGAATAGGTTATAAACAAAACATAATATAACGTATAGGTATTCGAATGAATAAATAAGTA
TGTAAATAGGGCATCTGCATGGAAATAACTGGGTAAAACATTACAATGTATTTTTTTAGA
GTTTTCACTATTCCGACGCGTCTAGTGTGTCATACAAAACGCGAAGAATCTGAAATCGTG
AAATATACTTAAGAATATAACTGAAATAGCTTAAGCATAA
Chromosomal Coordinates Chr XVI from 96153-95372,96258-96234
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator