Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL1a
Systematic Name YPL220W
Alias SSM1
Description N-terminally acetylated protein component of the large (60S) ribosomal subunit, nearly identical to Rpl1Bp and has similarity to E. coli L1 and rat L10a ribosomal proteins; rpl1a rpl1b double null mutation is lethal
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL1A	6325036 upstream sequence, from -1000 to -1, size 1000
ACTCCAGGTTCAAGCCAGCAAAGGATGACAGAGCATCTTTCCAAAAGCATGCTATTCCTC
ATGAAGGTGCCTTGAATAAGTCAGTGGCCAACGAATTAATGGCCCTAGGTAATGTGGCAA
AGGATCATACCGAAAATTGGGAATACGAACTGAAGAGTCAAGAAGGTAAAAGTGAAGATA
ATCTTTTCGGAGTTGAATACGATGACGAGAAAACAGGAACTAATTCAGAGAATGCTGAAA
GTAGCAGTAAGGAAACCACCCGTCCAACCTTTTCTGAAAAGGTTTTACGTTCATTATCAA
TCAAAAGGAATAAGAGTAAACTGGGCAGTTTCAAGCGCAGCGCTCCGGATAAGATAACAC
AACAAGAGGTTTCTCCTGACCGCGCCAGCTCTTCGCCTAACAGCAAGTCATACCCCGGTG
TCTCGCACACCAGGCAAGAATCTGAAGCGAATAATGGGCTAATCAATGCATATGAAGATG
AGCAATTCAGTCTGATGGAACCAAGCATACTGGAAGACGCTGCTAGTTCCACCCAAATGC
ATGCTATGCCAGCCCGAGATTTGAGCTTGAGCAGTGTTGCAAACGCCCAAGATGTTACTA
AAAAAGCAAACATCCTGGATCCTGATTATTTGTAAGCTTTGTCGATGGGATAAAGGTAAA
AAGAACAACGTAATTAAATCATTACGAAAACTCTACTGCATTATTTTTTAGTCTTTTTAT
AGAGACATGAACATTCAATTACTTTCAAGGATAAATATTCTAATATTCATATTATTCACT
TATGTATTTTTAACGAAACTCTACTCCATTCTACTGGGATCGGGCATACTTTACGGGGTG
CACGGATTTTAGCAGTCTTTTTCTTTCTTGGCTTTTGCGAGATGCCTTGAGAGGAAGATT
TTTTTTTCACTCAAAACCTCTGTCTTGTACATATCTAGAACATGTTTCATTGATATTGGA
CGTTACTATTTCAATTTAACAGTCAACCAGTCGTCCAAAA
Chromosomal Coordinates Chr XVI from 135790-136443
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator