Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SPT14
Systematic Name YPL175W
Alias CWH6, GPI3
Description UDP-GlcNAc-binding and catalytic subunit of the enzyme that mediates the first step in glycosylphosphatidylinositol (GPI) biosynthesis, mutations cause defects in transcription and in biogenesis of cell wall proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPT14	9755344 upstream sequence, from -1000 to -1, size 1000
AATTGACCATTATGGCTCATTGGGTTAAAGTTCTCCTCATTTAAGGGAATATCAAACCCT
TCTGTATCATCCTTTGAATATACACGAAGTGAGACATTTCCTGGGTAATTCGAATACGCC
ATGAACTCCTCTTCCCCAGCTAGCCTTATACCATTTTTGTCGAACGACTCTTTAATATAA
TGTCTAATAGCGGCATCACCACTTGTTCCTGACATGTGGGGCATACTACTAATATACTCT
AAATCTCTTTCTATCTTTGAAAGGTCTATCGATTTCCGAGCATACTGTAAAAGGAGATCA
TGGTCCGAGAATGATCCATTTGAACCTCGAGCTTTTCCATTCGGTAACCTATCACTCGCA
ATAATCAACGCTGCAATGATAGACATCATCATGATGTAAAATATTCTCCTCATTACCATA
ACATTACCTATTTTACTTAAGAACAAATCGAATTTCTCAGAGGCCAGGGAAATCATTTGT
GCTAGCGGATCCACTACATTTTTCTTTACTGGAATCACCACGTTATTTTCAAAACACATA
CGAAATCGCTGGACTTTCTCACTAAAGGCTTCCGGAGCCTGCGGTTCTTCCATCCCCATC
TCTTCCACATATACCGGGGGTTCTGATGGCATTCCTATAGCTTGCTCAAAGTCCTGCGAG
TTTAGCTCATCTTGTGAGTTATTTGCTGGTTCTTCAACATTCGGAAGAGTAGTGTAGCCC
CTAGTATTCACCATATCCTTTGTATACTCATATGCGAACTTGTCTAATACAATGTATACC
AAAAATAACAGCTTGAAAAAAATCTCAGGGTCTTTTCATTGAATAATCTCATTCTGCTAT
TTTAAGTTTTTCGTTTGCAACCCGAGACTGTCGAGCTAGAAAATTTCATTGATACGATTT
AAAAATAATCGATGCCAGTAATAGCCTCAAAAAACTTATGCAAAAATACGAGATACTATA
AACTACAGCTTAGCTAACTCTAACATTATTATATAAAACA
Chromosomal Coordinates Chr XVI from 218630-218646,218747-220088
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator