Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PEP4
Systematic Name YPL154C
Alias PHO9, PRA1, yscA
Description Vacuolar aspartyl protease (proteinase A), required for the posttranslational precursor maturation of vacuolar proteinases; important for protein turnover after oxidative damage; synthesized as a zymogen, self-activates
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEP4	6325103 upstream sequence, from -1000 to -1, size 1000
GCCAGTTAGCGATACAAATAATAACGGCAATAATTCGGTACTAAACGACTTGGTAGAGTC
ACCGATTAATGCGAATACGGGGAACATTTTGAAGAGAATACATTCGGTAAGTTTATCGCA
ATCACAAATTGATCCTAGTAAGAAGGTTAAAAGGGCAAAATTGGACCAAACCTCAAAAGG
CCCCGAGAATTTGCAATTTTCGTAACCAAGGACAAATACCCATAGAAAATGCTGCCCCTT
TTTAAGAGAGAAGATGGTAGATACCAATACTCAGAATTCATCTATTCATAACTTTTTGGG
TTTTTATTACATATAGAGTGACGTTTTGATACGATTTACATTTTGAAATATATAGATTTT
TGTATATTAATAAGTTTTGATTTTCAGTTTTAGTTATGCTTAATGAATTTTTGAATCAGA
AAAAGAAGTTCTGAAAAAAACATAATCCTGCTTGATGTGGTACAACAAGCTCATAAATAA
TTTTAAAAAGTTTGTTAATCCGTTTTCAATATCTTGAGCTCCTCAATTGTATTTGCTGAG
GTCTGATTATTTCTATAACCAAAAGCGGTTATTGAATCTATGGAGAGGCTGTAACCCGTC
TTATGCCTTCCGGGTACTATATTTCATTTGCGGGTGTCGATGGATTAAGGGGCGGAGGCG
GCCCTTTTTAGGATTTATATAAAAAGCCATACTTCCGTACTTCGTAACCTCTTATCAACT
GGTTAAGGGAACAGAGTAAAGAAGTTTGGGTAATTCGCTGCTATTTATTCATTCCACCTT
CTTCTTTTTTGAGCGAAGCCTTTATAATCAAATTTTAGTGGTCTTTTCTATTTTTATTTG
AGAAGCCTACCACGTAAGGGAAGAATAACAAAAAGTATATCTCACCCTACTGTATTCATA
AAAAGTTTTTTCTATTAGAATTCTATAAGAAAAGAAAAAAAAAAAGCCTAGTGACCTAGT
ATTTAATCCAAATAAAATTCAAACAAAAACCAAAACTAAC
Chromosomal Coordinates Chr XVI from 260931-259714
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator