Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NAN1
Systematic Name YPL126W
Alias UTP17
Description U3 snoRNP protein, component of the small (ribosomal) subunit (SSU) processosome containing U3 snoRNA; required for the biogenesis of18S rRNA
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NAN1	6325131 upstream sequence, from -1000 to -1, size 1000
TTTGGACTGACCTCTTTTTCTTTCTTTACTTCTGGAGATTTCTTCTTGGCCAGTTTCACA
GCACCAGCGGGTCCCTTTGGCTGTTCAAAATCGCCGGCCTCCACACCCTTCTTTATGGCA
TTGTTGAAGTACAAATCAAAGTTGCTTGCGGATCCGACGATCGGGTAGTTTTCCTTGATA
AACTTCTTGAGTGCCGGACGACTGGATCCCTTACGTTCCTTCAAAGCCGTGAGCCCTTCA
ATGATCAACTCCCTGTAACTCTTGGAGGAAGCTTCCTCCTTTTTTGCCGTGGTTTTCTTG
ATAGCGGCCTTGGAAGTTGATTTCTCCTTGCCTTTGCTGGTTGCAGGCTTCTTGCCCTTA
CTTGTGGTCTTGGTAGTGGATTTCTTGGGTGCCATGTTGCTTTAGTTGTATTATAATTGC
TTCCCTCGCTGCCAAGCATTATCAGGTGCCCATAAATAACAACTCCCCAAATCTATAGTT
GCTCCTCCTCTTTAAATAAAGGCAGATAAACAAAAAACTTTGACCGCCCGCTTTTCCACA
CAAAAAACAAACAACAGCAGAAAACGCGACGCGAAAATGAAAAGCCAAAGAGAACAAACA
AAAATCATCCATCAAACCTGTTATTGTGCAGAATAGCTTTTACCTAGACGCAAGTCCCTA
GGAGGGGGCATTTTTGACACAGAATAGCATTTCATCAAAGCAAACAGCAACTTCTTGGAG
ATTTGTATTGCTTGGCATGTCAAAATCTAGCGGTCACATCAGTAGGGTAACAAAATAGCA
CGTCAGGGTTAAGGCGGCCTACTGCTTAGGGTACGTGGTAAGTGATGTAAAATGTGAGAA
GGAGAAACTAGAAAAAAATTTTCCTTTCTTTTTCCTAGCGATGAGATGAGATGAAATTTT
TCGAACAAATGATTTTTGGCACAGTTTACATATCAGTTATATTGGCTGTCGTCACAGGAA
CTACAAGTACAAACCAGAACCATTTTAGCTGATCACCAGA
Chromosomal Coordinates Chr XVI from 310210-312900
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator