Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name IDI1
Systematic Name YPL117C
Alias BOT2, LPH10
Description Isopentenyl diphosphate:dimethylallyl diphosphate isomerase (IPP isomerase), catalyzes an essential activation step in the isoprenoid biosynthetic pathway; required for viability
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IDI1	6325140 upstream sequence, from -1000 to -1, size 1000
GCTTTTGCAGATTCCGGTATTTGTGCGGCAGCTCGAGCTGCCGATATGACATTAGGGTTA
TTTTGAACAAATGCTTGAAATTGCTTATAAAATCTCTCCAATGGATCTGAATGCTTGGAA
GACATATTATATCGTCGAATTTCTCTGTTTACTTCCAGAGCCCTTTTTTTCGTTATATTT
TCAGTGACTTAAGAAGTATTGGAGAAACTGAACTGATCAACTCCACACGAAAAGAAAGTT
TGTAATTTGGAAAAGGACTAGTTTTTCAAAAGAGAAGATCTGATAATAGATCAAGCGATA
AAAAAATTAACAAGATCTTATTGTTCAATTCAGAAAAAAACGTAAACAAAAAATAGTTCT
TCATGTTTAAAGGAAAGAGTAAAATAGTATTATCCCTTGATTAGTTGTTTACAATTCTTG
AAACTTTCCCAAACTGTTGTTTACATTTCTCTAAAACAAAAATAAAAACATGAGCAGGGT
AACACTCAAGGGTCCTAAAAAAATTAGGTTTTATTACAGAAATTGTATAGGACATTTTTA
ATATTACGAGGGTAAATAAATAACAGTCACAGAATAGTATAGGTTATTAAGGGCTTCATG
CGGCTATTTTGCCTATATTAATTTCTTTTTTTTTTCTTTTTTCTTTTTTTCCGCTGCTAT
CGGTAAAAGTTTCCGTTCTTGCTGGAACGAAATGGACAAAACTTAATTGTGATTGAAATT
TTTCCAGTCAACAGTTTCGCAATGACGATGCCCAGCCGATTCTTTTCCCTTTAATTGTTA
TTAAGAAACATGATTATTCATAACTCTTTTCTTGTCGATGGGGGTTGCCTTTCTTTTTCG
GTCTTAACTCCATTTATATTTATTTATTCATTTTTATCTATTTAACAGGAAACAGTTTTC
TAGTGACAAGAAGGCGTATATCCCACTTAATTCAATATTAGAGTATTCGTATTTGGAATA
CAGGAAGAGTAAAAATAAGCCAAAAATTCATTACACCTCA
Chromosomal Coordinates Chr XVI from 328730-327864
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator