Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BRO1
Systematic Name YPL084W
Alias ASI6, LPF2, NPI3, VPS31
Description Cytoplasmic class E vacuolar protein sorting (VPS) factor that coordinates deubiquitination in the multivesicular body (MVB) pathway by recruiting Doa4p to endosomes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BRO1	6325173 upstream sequence, from -1000 to -1, size 1000
TGTCTACTGATGAGGCAAAGAACAGAAAGGAAGAAAAAAAGAATGTGAATATGAAAAAGG
AAACAAAACCAAGTAACAAGGACATAGATGACAAGTCTAATGGTTGGTTTGGTTGGTTGA
AGAAAGATACTGGCGACAAAAAAGTGTATAAGGCCAAGCTAGGTCATAAAAACACACTAT
ACTATGATGAAAAATTGAAACGTTGGGTGAATAAGGACGCAACCGAAGAGGAAAAACAAA
AAATTATTGAAAGTTCGGCACCACCACCTCCTCCAATCGTGAAACGTAAAGATGGCGGCC
CAAAGACAAAGCCACGTTCAGGCCCCATCAATAATTCCCTACCTCCAGTACATGCCACAT
CAGTTATTCCGAACAATCCAATCACTGGTGAGCCTTTGCCGATCAAAACATCCCCTTCTC
CTACAGGACCCAATCCAAACAATTCTCCATCACCATCCTCTCCCATATCAAGGATTTCTG
GCGTAAACTTGACTAGCAAAAAGGCAAACGGTTTGGATGATTTATTGAGTTTGGCAGGAG
GACCCAAACCAGCAAGTACGAGAAGGAAGAAGAAAACAGCGAGAGGCTATGTTAATGTAA
TGGATAACATACAATAATTATAGTAATACGTTTTTCTTTCATGGTACCCTTATGCCTTCC
CTTTTCTTGATGTATATTATATACTTATAAAAACCGTAGTAAATTTTATTAAAACAATGA
TTACAGGAATCCGTATTTAGGTTATGCATCGTTGTCAGTAAGAAATCAGATGAATGCGAT
CTGAAACTTTGCTTATACTAATATTATTCTATCATACCTCATTTTCTTGCTTCGATTAAT
GCAGGACGCCGGTTCCGGGTTAGGATCACCGAGAAACAGAAAGCAAGCAAGGCTTCAGTT
ACAATTCGAAGAAGTACTAAGGGGGTTGTCGTGGAAAAATCTTGAATCAGAAAGCGGCTG
ACTGGAGCATTACTAGGTTCATTACTCACTGGTTCTACTC
Chromosomal Coordinates Chr XVI from 394038-396572
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator