Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CTF19
Systematic Name YPL018W
Alias MCM18
Description Outer kinetochore protein, required for accurate mitotic chromosome segregation; component of the kinetochore sub-complex COMA (Ctf19p, Okp1p, Mcm21p, Ame1p) that functions as a platform for kinetochore assembly
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTF19	6325239 upstream sequence, from -1000 to -1, size 1000
CCAGTAAAATTTAACCTGTCAAAGTTATCCAATCTTTGAGCCTCATCTAGACATTCTTCT
AAGGTGTTTTTGAACTGCTCAGAATTTATTTTTTGGATTTTTTCAGCTGATTTAGTGTTT
TCCTCTAAATCATCTAATTTTCGCAAGACAGCATTATATTTGGAAATTTGAAATGTGTAA
ACCTTTTCTAGTTCTTTATCCAAGGCCTCCACAAAATCAGATTCATTCCTTTCGGACCAA
CTATCCACGGAACTACGGCCATCATGTATGACGCTTTCCTTTAGTAATTTCTTCAACCTT
TCATAGTCGATATATGAATCCTTCCAGGGAGGATATACGTCGTTAGCCAGTTTAATACCA
AATAGCATTTTCAAACTCTGAAAACCAAGGACAAATTCTGCTGTTCGCTCTAATAGCCAA
ATGACCTATAGTGATAATAAAAAAAGCGCTAAGGAGGTACTACTTGGATTAGATCACTCT
TATGCGTATTATTACCCGCCAATGGGCCCTCTCGATATTGAGAAGATGAAGTAAGTTCGA
GAAAAGATGTCTGATGTAAGCCGCTCTCTGGCCTCTATTTAAAAGTTCTTCCTGGATGAA
ACCCACTCGAAAGTTGGGTGTGTGCGTGTGTGTATGTTTCCACGTTTCTGCCTTGTGCTT
TCAAAATCGCATGCACGTGCTTGCGACTGCACTGTGTTGTATTAAGCCACGTGGGCCCTC
GCACATTGAAAAAAAGAAAAGCTGTACAGGGAAAAATGTGCCAAGAAGTCCAAATACCAA
TAGCTGTGCAAGTTACTCATTAACATCCAAACCGTGAAGGTCACGGCATATATACTCTGG
CGTTCTACTATGTGGCCGGTAATGTAACCGGTAATGGTGACTATCTAATAGTTGGAGTCC
GCCGAAAAATCAGAAACGCGTAATTTAGACTTATATAAACAGCTATATACCTTGGAGCTA
GTGTGATCTTGTTGATACTAGGTCGGCAAAGAACGCAAAT
Chromosomal Coordinates Chr XVI from 517651-518760
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator