Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TAF3
Systematic Name YPL011C
Alias TAF47
Description TFIID subunit (47 kDa), involved in promoter binding and RNA polymerase II transcription initiation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAF3	6325246 upstream sequence, from -1000 to -1, size 1000
CAACATATACTTATATATATAAGTAGATACATATATATGGAAGGGAGAAAGTAAGACACT
GCATATATACCATATAAGACCAGCTAAAATTTTCTTCTATCCGCTTTGCCTTGTGATCAT
AAGCCTTGCTGTAACCTTTCTTGAAACTTGCTCTTTGCGAAACCCCACGCGCCTAAGAAA
CCCTTATCCAAATCTAATGCCATTTGGGGTTCGTTCGTAGGTGGTTTAGAAACTCTGGAT
GCAATAGTGTTAGAGTCAGTTTCGAGGATAACACCATTATCAATGGTTTCATCAATAGCT
AATAAAACCATATCATAGTTTTCTTGGATGTTTTTTTTGTCCATTCCTGAGTTCAAAATC
AAATCCAAAGCTCCTCTGATTGCTGAAAATCCTTGCTGAAGAACAATTTCATTCTCTTCC
AGCGAAGCAACTAAATATATCGTGATATCAATGTATTCTTTGTAAAGGACTAAATGATCC
TCGAAGATTAAAATCTCCGAATCTTGCTTGTGAGTCTTACGGTATAGTTGTTTCTCAAAC
TCTTTTTGCTTCTTCACCGAATTGAAGAGCAATTGGTGTCCTTCATCAGATCTATGAGGA
GGTTGATAATACTTTGCATAAATTCGTTCTCCTTGCTGATCTAGTATTAAAACAGCCTGA
ACAGTATATAGCGATAAAGAAGACATCCTGGAACAATGATGCACAGTACTCAAAATTAGC
AAGCCAGCTCACAAACAAAACCTAAATGCCTAAAGAACTTCTGTCTAGCAATAACTTCGA
TATTCCACACCTTGTAGCCTAAACAATGCAAACGTGTTTTTTCACTTGACAGAAGTGGCG
AAACGGGTAAGCTCGCGATGCTTTAGTTTTTTTTTTCAGTAATTTCATATTGCATGATGA
AGGTATGCTAATATAACACTTGAAGTAGCTTCCTGAGCAATTCCAAATCACCTACTAGCG
GAAAACAGCGATATCTTTGGGTCAATAGAGTTCCTCTGCT
Chromosomal Coordinates Chr XVI from 534703-533642
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator